Description :
From Genome Similarity Track
Location :
Scaffold_1:324974- 326664
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000473Similar to PEG10: Retrotransposon-derived protein PEG10 (Homo sapiens)

Sequence
1690 bases(100 bases per row)
GATCTTCTTCTTCTTCCAGTCAATGCTCGGTTGGTACCTTCTCAACCAGGGCATTCCCAGAATCAGATCAAACTTGTCATCGAGGTCGAGTGCTATAAAC
TCGTCTTCACCTCGGAAATCATCACATTCGATTGCCATACGCAACACGCGCTTAGGCATCGTCACTTTCGACCCATTCGCCAAGCGAACGATCATTTCCT
TGTTCGAGATAGGCAGGTCCAAACCTTGCCTTCTCGCCACTTGTGTGCGGACAAAATTGTTCGACGCACCAGTGTCTACAAGAGCCCGTAGAGGTTCTGA
GTAACCATCTACCTTAACCTTGTGGACTATCAAGGTTGGCTCTTGCTCGACACGCTCACATCTGTTCGCGGAAACTTCATGTGCGTTACACACACCGGGG
CAAGAGTTCTGCGCTTCCACGACATTCACAGAACTCTTAGTTCGCCCAGTAGGGAGCCCCGCTCCTACTGGTCGTTCCCGTTTTTTGGCTGTTGGGAACG
CTCAAATTGTCGGCCTCTGCCTGGTCGATTCGATCGCGGACCGTGCGTCGCTTGCTGGCTTGGCAAGGACACCTTGCAATTTCTCGCGATGTGGCCGGGC
TTGCCGCAACGGAAACACTTCCCGTCATTGCGTGGCTGTCGACTTGCAGTCACATCGGCATACGAGATGTCCATTGGCTCTGGGCCATTGTATGTTGTCG
CTTGTTGTCTTGGAGGTCGAGCGACAAAACCGCCGAACTTGGCTTGCTTGATGCTGAATTCTTCTTGCATCGCTCGCTCGATAGCTTCATCCAGCGTCTT
GGGGTACTCGCGGAACAACTGGTTCCGAATTGGACCATCATTGAGCCCTGCCATGAATGTCACAACTTGTGTTGAGGCATCAATCGGCTCATTCACGATA
CTTGACACAAGGTATCGTGCTCGTTGAGCGTACGAGTGTAGGTCGTATTTACCCTGACGAAGCTTTAAGAACTCTACGCGAGCCCGAAATTCGCTCTGCG
GAGGTTCAAAAGCCTTCTTCAGCTTTCGCTTGAAGTCGTCCAGGTCGTAGAAGCAATGTGGCTCCGCCAATCGCTTCCCATACGCCCAACTTTTCGCTCG
ACCCGCAAGCTTTGACATCGCAAACAACACTTGCTGTATTGGGTCCCGTAGTTGTCTTGCAGTGATCGCTGCATCCAACTCAACGAACCATCTCGCTAGA
GGCTCGTTCTCTCCGCCACGGTACGGAGATACATCGAGCTTCAGAGGTGCTACTCTCATCGTCGTGACAGGAGTTGCAGACTGTCGATGAGAGTTCATGA
TCTCGTGATGCATGAAACTCGTAGCCGCGTTCCTCTGCTCATCCGGTGACGCTGATTTCAGCAAGCTGATCACAGCCGCCTCACCGATGACCGCTCGCAT
ACGCTCGAGGGCTGCCCACTCGTGGCTCGACAAATGAGGAAAATGCTCATTCGTCAGCTCCACGGTTTCTCCAGGCATCGAGCCCATCGGTGTCTCAATT
CCTTCCATTGTTTCTCACAATCGGACAGGGGTCTTGGAATGTCTGCGCACGCTACACAAGCGGCCTATGCAGGCTCTTGACTTGGTCGTTGGAAGGACTA
CGAAGTGCTACCAGGTGTAAGAGGCTATCCGAGACAGCCTCAAACACAGCACGCACGCTTGCGCTTGAGAGGAAGGCTTGAGAGGAACTT