Description :
From Genome Similarity Track
Location :
scaffold_457:3249- 5222
Transcript NameFunction/comments
g8527.t1hypothetical protein
g8528.t1 conserved hypothetical protein

Sequence
1973 bases(100 bases per row)
TTTATCGCGAAACACATAAACAGCAAGCTTACTTTAATTACAGTTTTATACCCACTACAATTTTGCCTAATATTCTAAATTCCAGCCAGTCCTGGATGTT
TCTGCAATTACATAAACAGCCGTGATGCGTCCTATTTTGTTGCAATTATAGCCTGTACCTCTTGGACAGATCACTACCGCACATCAGCACGCTCGACGCT
GTCGGCAAGGCGCATGTTCCTGCCGTTCAAGAACCTCTCGGCACGACAAAGGTCCGCTCTGCTTACTCGTCTATTTCGATGAGGTTCCGTCGACCTAACA
GCACTCTGTACTTTATTTAGTGCCGGATACGCTGTGCTCTGTGTGGCGTTGGGCTTCGGCATCAAGTACATGGACGACCACATGCCTCAGAAGGATCCAA
GCAAGGCCAAGGGGGACGGACTGGTGCGTACAGCAGTATCAATAGATGATCCCAACTGCCAGGCAATGAATCAAGCTGACCCAGATGTCCATTGTGTCAA
CTGATATTAACAAACAGGCTTGGAGCGACCTGGATGAACATGCAGACGCCAGGCGGAAGGCCTAGATATTTAGTCGCTATGGAGCGAGTTGCTTGCATTG
ACATGCGGAGACCGCAATCTTACTTGCTGGCTGCTTCCGACGGTGGCTACTTGTCTAGGTAGTGTGGACACGAGAGAGCTGCAACCTGTAGACGAAGGTT
TAACGCTGGTGCAGTGAGCGTGTGGCTTAACACGGCTTGGCATGGCAGCCCTTTCCTCAGATGATGTGAAAGCTAAAGCACAAACGACATGTCCCTACAC
TCTTTATCATGAGCCGATTTGTCGCTTGGACCCCAAACAGCTATGGTGGAGAGTCTCGCTGGACCAACATCCTTTTCCTGATAACAGAACTCTCACACTC
TCGCGTTAACCTTAGCTGTACGTACGTCCGTTGCGTCCACTGTCGAAGCATGTACAAGGCCTTCAGGAATTTAACTACTCAAGAAAGGTGAGAGCAATGG
AAGGCAGATAGATGCTGCGGACGTTTTCGACCTCACTGTCTGCTTCTTTTCCTTTTCTGTGCCACTTAGCGCTGGTTACGGCCTTCTGTGCGTCTTCTTC
GCCAAAGGCATCGACTACATGGACAACCACATGCCCGACAAGCGCGCGTTGAACGCTTCGACTAGCGAAGAGGTCGGACCATCGGCTCGTGCAGCGAAAA
ACTACTCATAAAACTCATGTTGTTTGTGCTGTAGATGGTATGGAACGACAGGAACAAGCAAGCGACGACAACGAGAACGTACTAATGAACAAGTGGATCG
AGCCTGCTATTAAGGAGATGGTCCAGTATTTGTGATTCCTTTGCCTTCGCCTGGGCACGTCCGCCATATTTACCGAAAGAGACGAGCAAGCGCTTGGATC
ATGCCACGGGCTGATTTCACGAACAATGCACCGAAAGCTGTATCATACACCATCATAATTATAAAGCGTTAGCGTATCACTCTACAGTAAAAACGGCAAA
ATAACTCACCTTTTAAGCTGGAATTACCACCAGGAAAAGCTGATAGCGCAAAGGATCCCAGCGTCATCAGCTGCATCACAGAGCTCAGTACCACAAACAC
GTAGTTCCCCAGAATGAGACAGCTATACAGCGTGCACCCTGTTATAATACAGATCAGTCAGGGAACGTACACTTCAATGACACTTTCACCAACTCGAAGA
TATTACTTACCTAGCGTCACGAAATACGCGCTCGTCAATAGAAGTCGGTTCGGCTGCAGCAGCCCAGAAATGTACGCTTGCGGGCCCTTCAGCATGGCGA
ATGCACCCATACAGCAAATGCTGCCCAGGGTGAAGCTCAACGCGAACTTGGACGGTCTCACCATGATCTAAAAGCACACAAAACTTAGCCTTGAATCCTC
AAAACCCCACTTTAAATTCTGCCGTACCAGTGGCAGAAAGATAGAAGCCATGCCGAAGAACAGCATGCCAAGC