Description :
From Genome Similarity Track
Location :
Scaffold_154:32463- 36654
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_154-fgenesh-gene-0.144-nitrophenylphosphatase

Sequence
4191 bases(100 bases per row)
AGAAGCGGAAACAACAGGAGGCCACTGCGACTACTGCTACTACTACCGTCGAGACGGAAATCGAAGCCGTGGCTACGACGGTAAAGATGAAAGCGGCGAC
CGTGATTAAGAGCAAGAGCAAGGTTGTCGTTCCTGTTGTCGCTGAAGGAAAAACAAGCGCGACAAATACTGTAAACGGTGATATCGTTCGACGACAGAAG
AAAGTTGCAGCAAAAAGCGTAGCGTTCTCACCGAGAAAGACGTTCCCTGCTAAGACTCCGCATTCATCAGCACACACGACCCGACCACGCAGTCTTGAAG
AGTCATTCGATACCGAACAGGAGACCAACGTGAATGATACGCCAGCGACAGCTAAGAAATCAGCTGCAGATGAGCTCATGCTCATGCTGTCGCAGGATAA
AGCGAGCGACACCGAGGGAGAGGAGCCAAGTTTGCTCATGCCGTTCTCTCCGTCGATTCTTACCCCAGTGAAGAACGCTCCTGAACCGCGCTACCTCAGT
TACGGCACTCCCGAACGAGCTGAGCCAAAGGAAAGCAACAACCCAACACCATCGAAATTTACGCCTTCGAAATTGGCGAAGGGTGTGATGAAAAAAGCGA
TGGCTACAACTGAGGATTTCGATTTTACACTTCGAGCCGCAAAAGCAAAAGCTCAAGCCAAAAAGGAAGCACAAGCTGCAAAGGAGGCGCAGCAAGCGGC
AGAAGAGAGCGACAAGGAAGAAGAGCAAGCGACAAGCGCAGAGACGCCGAAGAAAGCTCTGAAACGAAGAAAAGATTTGGGGATCTCGTTCTCCAGCAGC
TCTTCAGCCTCGAGCAAAATTTCATCCAAATTAAACGGTAGCAGTAAAAGTGGTACTGAAGATACCAGCAGCAGCGCCGGATCACGCGGCGGGAAGAGCT
TAATGGAGATGATGGCTGCAGCTAGTCTTGTCGAATCGAAGATTCCGAAACCCAAAAAGAAGCAAAATCAACCAGCGAAAGACAGTGAGACGACGATACC
AACTACGACTGCTACGGAGAGCGGCAAGCCGCCGCTTTATGGAAAGAAGAAGGCTCAAAGTAAGCAGCCCGCGAGAGCGAAGGAAGCCGAAGGTGATTCC
TCGAGCGATCACGATGAGAACGGTACGGACCAATTAAAGCCGAAATTGACCGCGAAAAAGGCTGCGAAAAAAGACGCCAAATCGGGAAACTCTAAATCAC
AAAAAGTGGATGAAGCAGGATCAGCTGGAACGAGCGAACCCGAGGCTGAAGATTTCATCGATGTGAAGGCTGCAAATATCACGAAAAGAGCAAAACCGAA
ACAACAAAAGCAAAGCGCGAAAGAGAAGGAGATTGCTATGGGAAATGTGAACGAGCCTGAAGCTGAAGTCTCTGTTACGAAGAAGAAGACCACTCAAGAG
AAACAACCGAAAGAGAAGGGGAAGAAGAAAGACAAGCTGAGTGCTGTTGAACAAGCCATCGCGAAGGCTGATTTGCTCACTCGGATGTCGAAAATGCAGG
ATATTGCCACGCCAAAGGTTTTGGCAAAAAAGAAGAAGGTGTTTTCGAAAACTGCAGCAGACAGTCTGTCTACCAAGAGATCCGAAATTCCTGAAAATGA
ATCAGCAACTAGTGACAGCGATGGTGTAAGTACTCCGCGAAAACAACGAGCAATGAAGCGACAACTTGCTGCTTCACGTGAGAATGAGACTACACCAGTG
AAGAAAACAACTCCAGCGCCGTCGTCTTCGGCGAATCATTTGCATTCGCCTTCAATTGCAGCGTTGCTTGCGATGCGTCCGTCAAAGAGCCCAATTGGGA
TTCGCTATGTTCCTAAGACCCCCAAGACACCGCAAACTGTCCGAAGTAAGCGTCAACGACCTGCGCCATCAGATGCAGACGAAGATGCTCTGAACAACGA
CTCACCTGATGCGAAGAAGCGCAAATCGAGACCAAATGCATCGGGGGTCCCTGATGGAGCGGCAGTGCCAATGTCAGCGGCGGAGTATGCGGCGCAGAAA
CTGAGCGCAGGTTTAGTCACTCGTGCTCAGAAGAAGGCGGTGAAGGCAGCGCGGAGTGCGTTCGCCGGCACGACTGGCGCGCTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGGGCCGTCATTTTTCGATGCGTTTGTAAATGGTGGGGCGCCGCGTCTGAAGAAATCGGTGCTTCGGTAAGCAATTTT
GTTTTTGGGATTTGTAATTAATGTAAGAAAGTGTTCTTTACTGTCACAAGAGTGCGGATTTTGCGCAACATGAAGACGGTTGACGGCAATGTTGCGTTGT
TTCTTTGATAGATTCACAATTCAATTTCCACAGCTTCCTAGAGATACCGTTCTCACAAGTCTATGTTGTTGCCTTCAGGTGATTGTGGGCTACTGTAGTT
TACTTAGTTNNNNNNNNNNNNNNNNNNNNNNNNNGCGGTGGAGCTGGTTGAGCACGTCGACCGACTGGACGTAGTGGTGCGGCGTGAACTCCGGCAGCTC
GATGTTGGCCAATTCCGACTCGTGCGTGACACCCGTCAGGACGAGCAGCGTCTGCAGGCCACCAAGGCGGCCAAACGCAATGTCCGTGGAGAGACGATCG
CCGACCTGCAGAAGCAAAAAGTAGCGTCACACGTTAGTATTCGCCTGGTACGAGTTGTTCAAAAGAAACTGCTGCTTAAAGCGCACCATGCACGTTCGGG
AGGAGTCGAGACCGTAGGTGGTGAGGATGGTCTTGAGCAAGTCCTGTGATGGCTTGCCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCAGAGAAGAGACAATACCTCAATCAGTCCATCAGCCGATACACTCAAGAAAATGCGCAGCAGTAGGGAACTCTTCTTACTGTCCAACTGCGGACT
CGATGGTCTTGACGAGAGTGCCGCCACCTGGCAGAATCGCACCGTCGACTGGGAACGTTGGGTCACTGCGAACAGCAATGCACCACAGTTAGCGTTACTT
CATTGACGCAATGTTTATCATCGCATTGGGGCAACGTACGGGTTCGTGCCGATGAATCGGCAGCCTGGGATGTTGCGGATGCACACCGTCGCGTACGCGA
GCTTGTAGTACGAGATATTTCTGTCGAGACCGACGACGACCGCCTTAACGTTGTCNNNNNNNNNNNNNNNNNNNAAACGGCGTGTGCAGCTCCTTGACAT
CGCCATGCTCAAGACCGAAGGGCTCAAAGCCCTCGTTCGCGAGCTCTTCGCCAAGACCCGCTTCTCCGATATAGTACACCTTGCCCGAGATCTTCTCGTT
CGTCATGTATTTGGCCGTCGCCCACGCAGACCTGTTATGGCGCACGCATTGCCATAATCATCAATATACGTGCAGATTACGCAGACCTTGACGACAAAAC
GACCGCACTCACGTCACGATTTCATCCACTTCCGCAGGAATGCCTTGCTTGGCTACGGAAGGGAAACATTGTACATGCACACACATAGCGTCACGAAATC
CCGCTTAGCACGCTCCCATTATGTATATTACGGCAGCGTTTAGGAGCCAACACATACCCAGCTTCTTGACGTAGTTGGCTCGGCTCGTGGTCGAGTTGTT
CGTCTATTCAGTCATTCATCCATCCTTTAGTCCCCTCTCCATCAAGAACCCGATTTGCATGGCCAAGCGCAAGCACGTACCACAAACACGACGCGCTTGC
CAAGCGAGCGCAAGAGCCCCACGAGCTCACCAGCGCCGGGGATCGGCGCATTGCCGCGCCACAATACTAAAGCCATGCACACGCACAGTAGTCTAGTCAG
TTCCCCCCCCCTGGCATTGCTACCTACCCATAGAGACAGTAGTCATACGAACCTCCGTCGCAGTCAAAGAGGAAGGCGTCGAGGTTGCTGATCCAGTGCT
TCCAGTCGCCGCCCTCAAGCTTCTTGGGGATCAGTCGCTGCGCCATCGCGTCTCTCTCGCTTGTCTTATTGTGTTCTGCTTGGCGGGTCACGGCGCAAAG
CTCCAAATGACGCACTCCCCTCCCCACAACGCAGCAACTGTCTCTGGATACTGACACAGTCGGAGTATTTTTAGTAGGTAAAACGGGAAGCATATGAGAA
TTAGTATTTGAGATAAATTGTGTCAGTAGCCAAATGAGCGACACATGTCGCAGAGCGTCATAGAGGATGCACCCTTGTGTATTGGTTGATG