Description :
From Genome Similarity Track
Location :
Scaffold_4:324621- 331207
Transcript NameFunction/comments
Physo_128217hypothetical protein
Physo_128218hypothetical protein

Sequence
6586 bases(100 bases per row)
GAAGCTTCGCCAAGTTCGTGACGCCGCACACACAAGATTACGGAAAGCTTGATCGCTCCTGCAGACGCAGAGATGGAGACTGCGGATGTGCTCAAGGTCT
GTCCAGCCACATCCATGGTAATTGCCGGAGCTCGGTAGAACGCGTGCCCAACTCACTACTTCCGACTGGACGATCGAGTACTTTGCCATATCGTTGTCCC
GCAGTACAACGCCCATGGAGGCTACTTCATCTCTAATCGCACGACAATTCCACACGAAACCTCACCGACAACCTGCGCTGCTGATAGTTTGTCATTTGTT
GGTAATTTCTACCACGGCAGCATCGGATTCTACTCGATATATGCCGAGGCATCCGGGACATTCTGTACTTTGGACAACACTGCATACATATCCGTCAGCA
GGGTGGGCACGTATGACATCAACGGTCTCCAACTTGCTGACGACAGGGGCAGTGGGGGATACAGGATGTCGTACTGGAACATCTTTACTGGAACATCCTT
CACCCTCGTCAGGATCTTCACACAACGACGAAGCTTCGTCTCCTGTGGGAGATTTGTCAAACGCTGCGACCAAATGTCTGAGCCCCTTCGAGTACAAGAA
GCCGTCGTCTACGTCCAAGAGAGCATGCGGCTGTCGGCTCACGGAGCCAAGAACGTCCACCGCTTATTGCTGATGTTCCTCCTCGTGGACCAGGGGGTCA
TGAGCGACTTCTTCCTCCTCAGCACTCAGGAAGGAATCTTCGGACGCATCCAGTCCATCTCGCTCGGCTACAACTTGGCAGGTCTTATGTCCATGGTGTT
TGAGATGATGGAGACGATGAACTGGATGAACGAGAAGCTGCGGTGTCAGGTAAAGCGACTGCTATTCAACTACGAGACGGTCCTGATTGGTGAGTTCATC
ACTGCAGCAGTTCTGCAGCAATACCTGATATCGCTGAGCCGATCTCAACTCAAGGACACACAGCCGGCGGCAGAAGTGGTGTCATACTATTTAATGGGGC
CAGTCGGGCACATCGTGCTTGCCTTGGGTTGTCTTACGATCATTGTGTTCACCAGAGCAATTGGTGCTGTCGCATTCGCAAGGTGGAGGTTCGGTACGAT
TCAAGTGTTGGCGAAGACGTGCATCGTGGACGCCGCACTGGGTGCACGCAGTAAATTGATTCTGCTGAGCGGACACATCTGGGAGGACGGTGAGCTGTAC
TACAGACCTGGCATCTTGAAAGAGCTCGGGGTCCTAAAGGCAGTTGAACCCGACGGAAGGGAGCCTTTCGTGCACACAACGCTACATTGGGTATCCATTC
CGGATGACAATGTCGCCGTGCTGGGACTGTGGAAGATAGGAGAGTGGAGCCTACTCCAGAACGGCCGTGCTCGGGTATTGTGGCTTTCGTTGATCGAGAG
CTTGGCGGAGGTGCTGGGGGTTATCAAAACGAGTTTGGGGACACTTTGCTCCCACGAACAAATAGCTCCGGTCGCCGAAGCTGCTTCAGTCGTCAAAGTG
AGCGGGTTGGCTGCTCGGCAGACGTCCCAGGAGGACCAAAGACTAGAGTCCGTATTTTGCAGGAAGACAGCAACGTCTTACCCGTACAACAAGGTTCGAG
GGGTTTGCCTGGGTCTATCCAAGTGTTTGGAGGTTCTCAGCACATTCTCACACTCGTAGAGAACAAAATAGAACTGAAGTCCACATCTTCGTGATATTTA
TTGTTGATGGAATTTCGTGTATTAGTTGCATAACTTACAAAACGTCAGATGTGTAGGTAAGCCGCCTCCTTTGCCGAAGTAAAATGTGAACAAACTGATC
TTGCGTTGTCGGTGTCGTCCACTATCAATAACAGTTTGAATTAGTGGCGTGCTTCAGATAATGTGCCGCTGAAAATAGCGCCGTCACGGTGAGTACCCAA
CATCACTCTCTTTTACTCTACGTGTTGCACAGTATGGGAAAAGGCTCTGTCAGTCCCTAGACTCACGTCGTGGATATGTACGACCATCAATCTGGAATTG
GCTGGAGCAGAAATGGAGCGACCTTCAAGTGGGGCACCAAGGTGCCTACTCCATCGAACGACTTGCAAGTCTGGAGCACTACTGCAAAACTACCTCAAGA
ACTCGAGTCGCGCTGGTGTGCATTCTTACGCCATTGCCTGCATTGACCACGGCAGTACTGTTGGAGTGCTTGCCGTTGAGACCTCCATCTGAAGGGTGGC
AGGTGAATTGGATGTTCGGCATTCGTCTGAGCTTGGCCGTGTCAATAATTTGCTTTATGGGGACCTCCGAGCTTATCACGTTTCTCCCGGACGTCAACTT
CACAATGGCGTTTGGTGCATGTGCTGGATTCATGCTAATCTACTTTTCGCCGCCAACACTGTCGGATTCCCGGTGCCGTACACTTGGCAGACAGTGGGGT
CAGGGCAGGTCGTACTCATCCCGACAATGATTCTGCTTGTCTTTAGTCGAAAACCTTTTGCTAGGAGCTCGCCGTGTCGACAACATTTGAGCCGCTTTCT
TCGATTCTTCGTTGTATTCCTGGCGCTAGCTGTGACGTTTCCTTTTTTCAAAGTGCTCCACGACTTAGTACCCACGCACTATAACGCGTGGGCAGCTCTA
CTGTTGCCTGTGGTGGGATTAGCGGCAAAACATATCATCATCAAAGCGGCAAGGGAGCTGGAGGATTTTATTCCAGCGATCATTGCCTTCTCCGTGGATT
TGTTACACGCACTTTTCGCCTCCGTTTGTATATCATCATCGCCACCGATTCACGCTTCAGCTCTATACATCGCGGTGGGAGTAGATAGCCATCTAAACCG
CAACAAATTCAAATTCAAATATACATCGCGGTGGACTTGGGTCGGTTGTGGCTCGAATTTCGCGAAGTGTCCGCGCACGCAAATACGGTTCTAGAGTTCA
TTCGGAAACAGCAATCTTACGAGGGAAAAGAAGACGGCGCTGCTGCTGTTAGTGGGAAACTCCTAGCACGGATGATCGCCGAGATTCAAAATCCCGAATT
CTTGTACCTGGCATTGGTAAAACCTGTGCGCCTGTGGGCTTGCCTTCCACATCCCCTGACACAAGGCCAAAGAGACCAACTTCGTGTACTCGAAACCTCT
CAAATTGAAGAGTGGCAGAAGAAAGTATCTTCCAGCGAGGAAAGTCACCGTGACTTTCAAGTTGGAGTGGCAGCAGTCGTACCGGCGCACACCATCGAGC
GGTTCAACGCATTCGGCACCGCAAGGGAAACCATTCATTGTAGAGGGGTTGCAGCTGCTCTTCCAATGCGAGTATCTTGTGCTGGTTGAGTATGTTGAGT
GCATCATACCTGTCGTATTTACGGTCTACAAGTCAATCCTGCAGCAACTACCGAATGTCGTGTTCTACCCGGTTGGAGCTGGAAAGTGGGGTGTACGCTC
CATGGGGAATACGCTTGCATTAGCAGCACTGGAGGCTGCGTCGCTAGTGCTACTCCACCATCTTTTGCATCGCAAGTTTGGCTTTTCACCATTCTACCAG
CTTGGATTCGTTCTCGAGACGCAGATCCACATGGTTCAAATGAGGCTATTCCTCGAATTTGTGGTTCTACTGCAGTTTGAGCTCGAGCATCTTGGTGAGT
GCCTTGTGTTAATAAGTACCCTTCGTTGCACGGTTCTGACTCGCTTCTCTTTTCCCTGCAGGTGTTGATTTCACGTTTCGCTTCGAGTGGCTGCGTGGCA
ACAGTTAGCTTCCCACGATACGATCGTCACTGTATCATGCTCGTTATTGTCCGGTCCAGGGTATTTGTGCCGAGTAGCAATCAGAATGGTGCAAGGTTTC
AACCAAATGATCGCAGCAAAAAAACAAGAAACGACGTAAACCACCTCAACAATACAATCAACTCGTTGTGCTCCTTGGAAGAAAACATTGTGTTCGAGTA
CTTACCATGAAAAAAATTGAGTCTGTACACTTTTATGAGGTCCTACAATTGGTGTGGACCAAAACTCATTTGTGTAATTTATGTAAACTTAAACGAAAAT
AGACACTTGCGTCTATTCCTCCATAAGTACCACTTTCGCAAACCCGTCCCAGGCACAATGAAAGTGGTAAGTCGAGCGCCTCCGGACGCCTCTCCCCGCT
CTCCTAGATGCCCGCTCTCGACACTGCGATGTCCTCCAATTTGCCCTCGATCTCCTGCATCTCACCCGCGTTTTTTTTTCTCCGAACGATGCCCTGTAGA
TCCAACTGGGCGGCGCGAACGATGGATTGTGCCACTTTTTGAGCTTCGGCGGCTTCGAGATGCTCCTGGACTCCGGCGTCAAGATGCAGTCGCTCGTACG
CGAGCCACAACAAGGCGGGGGTTCTGTCTACCGCCTACAGCTGCCAGCACTGAGCTCCGTGGAGGTGGGGGCGCTGGACGTGGTGTTGGTGTCTAACCAC
CTCACTCTACTGGCTCTGCCGTTGCTCACGGAGGTGCTGGGCTTCAAGGGGCAGATCTACGCAACGCAGCTCACTTTAGACTTCGGTCGGGTGTTTCTGG
AGGAGCTGGCAGCTCTGACGCAAGGGGACGACTCCGCAGTCTTTGTGTTTGAAGGCGTGGCGGTCGGAATGGAGACAGAGCTGCCCATGCACTCGCTGAA
AGAGATTGAGCAATGCTGCAAGAAAGTTCGATGTGTGGAGTACAGTGAGGTTGTGTCACTGGCCTACGGGGTTCAGGTCACGGCGCTGAGTTCGGGTCAT
AGCTTGGGTGCGAGTATTTGGCTCATTGAAGGCCCGAACGACCGATTGGCGTACGTGGCGGCTGCCTCGGGAGACTACAACCGCCACCCGAAGGAGCTGG
ACTTGATGCCGTTGGTAGACTGCGAAACACTGCTGCTGACGGATCTGAAGCCGGATCGGGACCCCCACTCGAACACGGAGCGCATGGTGGAGCACGTACT
CAGTGGCGTCACTCGTGTGCTGGAGCGTGGCGGTGTTTGCATCGTACCGACGTCGCCTTGTGGCGTCGTGTTTGATCTCGTAGAGGCTGTGTATGCCGCG
TGCCTCCACAACAAGCAGAACGTCCCGATGTACTTCATCTCGGATCACGCCTCTCGCGTTATGGAACTTACTCAGCTCGGAGCGGAGTGGCTCTGTGAAA
AGAAGATTGAAAAGCTGTACGCGGGTGAGGACGCATTCCTGCACGAGTCGCTGCTCAAGAACGGTCTGTTCCACGCGGTTGCAGACGTCTCAGCTGCTAC
TGCTGCTACCTTTCAGGTACGTAATTTCGTTCAAGACGCCATGGGTTCTACCGCTGTCACTGAACATATTTTTGCTGTGTGCACAGAATGGTAGCATCAT
TTTTGCTGGCCATCCATCTCTCAAGTTTGGGCGTGCCCCAGAATTGATCCGCATGCTCGGAAACGAGAGCCGTAATGCTGTCCTGCTGATTGGTACGCCA
CAACATTGCCACAGGATGGTAATTCACGATTTAGGGTCTAATATCACGCTGTGCATCTTTTTTCAAAGACCCAGCAGTCGATGCCACCGAAGCCTTTGCC
CCTTTCCAAGATCTCAACATCGAAAAGATCGCGTGCCCAATCGACCCAAGATTAAGCTGCGGCGACGCTAACCAGTTTATTGCTCGCTGCTGCCCGCACA
ACCTGATCGTTCCGTACGAGTACACCATCGCTCCGTCGGCAAGTGCAGCGGAGGGAGCTGAGATGTCGTCGCACTTTTCGCGAGTACTTCCGCTCCACGA
GCTCACAGCGGCGAAAACCAAGACAGAGCTGCTCACCTTCCCAATGAAGCCGTTCGAGCCCATTGTGATTGAGAAAACATCGAAGTATCTGGATGGAAGA
CTTGACCCCAAGGTACCCAATGAACTGTCCGCTGATAATATGGATTGGGGTAGTCGATCTAACCATATTTCTGACTTTGCCCACTTGCTTTGATTGCCTA
CAGCTTGCTGCACAGGCCACAATCACGGAGGTGAACGGCAAGGCTGCAGCCTGCGTAAGTGGCGTACTCAACGTCAAGCGAACAGCATTTGTACTGGAGC
CTTCTCCAGTTGCTCCTACCGTACCTACGTCCTCCGATATGACCGACGACTCCAAACTAAAGGGTTCTGGGAAACGCAAAGCGTCGGCGATATCGGATGC
TGACACTAGCAGCACGCTCCAGAGCATCGACTACAAGGAAAAGAGCAACCTCCTTCTGGGCCAAGTTGACGAAGACAGACTGATGAAGCAAGTGAAAACG
GTACGCAACCTGGTGTCTTCACCTATAGCGAATGGAAACATTCTGACACTGTGAACTTTTGGCGATGTTTAGCATGACCCACAAGCTCAGGTGTACATTT
CGCAAGGCCAGGGAGATGCTGATGTGTTCATGAGTATTCCATCCCTCGATGCGCGGATCACATTGTGGAAAGAGACCGGGAAAACCCTCGTTGAGACGGA
GAAAGAAGATGCGCGGGCATTGCTGACGTCATTCATCCTGGCGCAGCTTGTAGTGATCAGCCAGGGCTAAGCACAAGGAAGAATGCCTGTGCCTAATCTT
GCTTCACAGAATACAGTAGATAGCATCCATATCCAGCACGGCCACGAGCGTTTTCGCTGCATCCTTGACGGACGAATCGTATTTTT