Description :
From Genome Similarity Track
Location :
contig_31:324589- 325995
Transcript NameFunction/comments
g7175.t1RAW22005.1 hypothetical protein PC110_g21553 [Phytophthora cactorum

Sequence
1406 bases(100 bases per row)
GGGATCCACAGCAGCAATGACCCGCCACCTGAGCCTGGCAAGCCGAGCAAGCCAGGCCGCCACCGATCGAGGTACATGTTCTTGTCTTGTAGCTCAGGGA
CGGTGGAGTCCCAAACCACCGTCTCACCTGCGCCGACGTCCACTTCGGCATAGTCTTCTCCACCCGTATGAATGACCACCGTCACATCCTCCTTATCCGT
GCTTTCAAAGATAAGACGAACGACTCCGTCACCCGCCTTGGTCCACGATCCGTAACTACCTTCGAACGCCTCATCCACAGTCATGAGACCCAGCGCATCG
TATAGAGTGCCATCGTCGATCTCGCCAAGGTAGGCGGTGGGTCCACAAATGGGCTGCACGAATTGAGACGCCAAGTACGCGATCCCTGTGGGGTCGACCG
TTGAGAGCACGACGAGGCCCATGTTCGAGACTTCGAGCAAATACTCGTCTTCCGCGACGGATGCCCCCATATCTGTCGTAGCCTTCTCAATCAGCTGGTC
AATAATCACACTGAACGTTCTCCGGAGTAGATCACGCGTCTCGTAGGCTGCCGAGATGGTCTTCGTGGTTAGCAACTCGGCCATACAGTTGTTGGTAACC
GCAGGAATGTCATTTAGCACAGTGGGGGACTTGTACACCGTCACTCGAATGTCATTGACGGCAGCGTTGGGTGTGTCATTGCGAACGTCGTTGACAGCGT
AGACGACGCGATCTGCGAGACGCTTGAGCTCCCAGCCACACGTTGAATTCTTATCGATGAGGTCCTGAAGTTCGTCCGTCGTCGTAGACGAATCGTTCAG
TGCACCACTACCTGTGAGCATGTTCAGCACATTCCCCCCCGTCGACAGGATTTCATCACCATTTGTGATGGCTTGCTTCACGATGCCTTCTACGACCGTC
ACCACCATGTCGATATACTGGGCCTTCTTCGGGACAGGCAGGCCAAGGCAAGCACACACGGCGACAGGCAAATCAATCAGCACGACATCAGACTGGTAAG
CCACCGCCAGCAGCTCCTCTGTGTCTCCTTGGGGCGCTGTGGTTTGCTGGTAGCGGATATAGAAAATGAGAGACCGCACCACCGAGATGACGTTGGCGGC
GCACGTGATGGCCCACTTGGCAGTTTTGTAGGCAGCTAGAATTTCTCCAAACACGTTCAAAGTGGCGATATTAAACGCCACAGCCACGACGGAGCCAACT
TTCCAGATAATCTCGAGAGCACAGTCGTCATTTTGAGGAATGCACTCCGCGAAACATCTCACAGGATATGATAACGGGCACTGCGCTAAGCAGTCATCGT
CGTCGTTGCCGTAGCCTATTGGGCAGACCTGGCCACTGCCGAAACCTACCGATTTCCGGTAGCATGCGGTATCGCTCGGGTTTCCAACCTTCGGGCCGAC
CCAATT