Description :
From Genome Similarity Track
Location :
contig_31:324567- 325973
Transcript NameFunction/comments
g7518.t1hypothetical protein

Sequence
1406 bases(100 bases per row)
GGGATCCACAGCAGCAATGACCCGCCACCTGAGCCTGGCAAGCCGAGCAAGCCAGGCCGCCACCGATCGAGGTACATGTTCTTGTCTTGTAGCTCAGGGA
CGGTGGAGTCCCAAACCACCGTCTCACCTGCGCCGACGTCCACTTCGGCATAGTCTTCTCCACCCGTATGAATGACCACCGTCACATCCTCCTTATCCGT
GCTTTCAAAGATAAGACGAACGACTCCGTCACCCGCCTTGGTCCACGATCCGTAACTACCTTCGAACGCCTCATCCACAGTCATGAGACCCAGCGCATCG
TATAGAGTGCCATCGTCGATCTCGCCAAGGTAGGCGGTGGGTCCACAAATGGGCTGCACGAATTGAGACGCCAAGTACGCGATCCCTGTGGGGTCGACCG
TTGAGAGCACGACGAGGCCCATGTTCGAGACTTCGAGCAAATACTCGTCTTCCGCGACGGATGCCCCCATATCTGTCGTAGCCTTCTCAATCAGCTGGTC
AATAATCACACTGAACGTTCTCCGGAGTAGATCACGCGTCTCGTAGGCTGCCGAGATGGTCTTCGTGGTTAGCAACTCGGCCATACAGTTGTTGGTAACC
GCAGGAATGTCATTTAGCACAGTGGGGGACTTGTACACCGTCACTCGAATGTCATTGACGGCAGCGTTGGGTGTGTCATTGCGAACGTCGTTGACAGCGT
AGACGACGCGATCTGCGAGACGCTTGAGCTCCCAGCCACACGTTGAATTCTTATCGATGAGGTCCTGAAGTTCGTCCGTCGTCGTAGACGAATCGTTCAG
TGCACCACTACCTGTGAGCATGTTCAGCACATTCCCCCCCGTCGACAGGATTTCATCACCATTTGTGATGGCTTGCTTCACGATGCCTTCTACGACCGTC
ACCACCATGTCGATATACTGGGCCTTCTTCGGGACAGGCAGGCCAAGGCAAGCACACACGGCGACAGGCAAATCAATCAGCACGACATCAGACTGGTAAG
CCACCGCCAGCAGCTCCTCTGTGTCTCCTTGGGGCGCTGTGGTTTGCTGGTAGCGGATATAGAAAATGAGAGACCGCACCACCGAGATGACGTTGGCGGC
GCACGTGATGGCCCACTTGGCAGTTTTGTAGGCAGCTAGAATTTCTCCAAACACGTTCAAAGTGGCGATATTAAACGCCACAGCCACGACGGAGCCAACT
TTCCAGATAATCTCGAGAGCACAGTCGTCATTTTGAGGAATGCACTCCGCGAAACATCTCACAGGATATGATAACGGGCACTGCGCTAAGCAGTCATCGT
CGTCGTTGCCGTAGCCTATTGGGCAGACCTGGCCACTGCCGAAACCTACCGATTTCCGGTAGCATGCGGTATCGCTCGGGTTTCCAACCTTCGGGCCGAC
CCAATT