Description :
From Genome Similarity Track
Location :
scaffold_317:32452- 34752
Transcript NameFunction/comments
g7199.t1 hypothetical protein PHYSODRAFT_485789

Sequence
2300 bases(100 bases per row)
AACTATTTCTAGCATATTCTGCGTGTATCCAGGTGCAGGGTCCTTGATAGCAGTGGTTTGCAGCAGGCGTTGGTGGTGATCGATCATGGCATTCAGAGCG
CCAGAGCGGTGAAGAGCGCGCAAGTACTTGGAGACGGCGCCAGACCCGCGCGACGTCGTCTTGTTCTCGGCCAGGAATGCCAGAACTGCTGCTTCCGCCT
GCTTGCCATGGCTCAAGACGTGGTCGCGATAGCCGGATGCAGTGCCGTCCAAGATGAACCCGTCGCGTAGGAAGAGCTTCATGAAAGCTACCAGCAGCTT
GGCGTTCGACTTCTGCTGCTTCGAGATGGATGCTAGCCACAGGCGTGGCTCCTGAGCGTACCACACGAACCACGTCGCATGAAGGTGAGTCACTGATCCT
CGTCTTTGCTTGGGCTTCTCCTGGTCTTGGCTTGGTTGGTGCTGACGCTTATTGCTTCTGTCTTGTGCTGCTGGCTTTCCTTCCATTTTAGCTTCTAGGC
CATCCATCCGCTCATCTTGGCGCTTGATGTGCTCCATTAACTGGTCAATCACACTACGGTGGTGATCGATGATCTTGCTCTCGTTCGTTGGTTCCTTGCG
AGGTTGGTCTGCTTGCGCTTGGTGTGGCTTGAGTTTGGTGTCTATACAGGTGGCAAGGTGCGACGACCAAGCTAGTAGTTCAGCGACCGACGATCCCGCG
TGTTCAACAGTAGCCTCCATGCGCCGGACAGCAAGTCCATCCTCGCGAAGCTTCTTCATCATCGGGTAGTGCATGATCAGGTAAGCAGTAAGGACGTCTG
CGACCTGTTGACTGATGTTGTACTTGGAGCTTTCAAGCTTGTAGCAGGTTGTGAATAATACGTGCTGGACACGGCCGATCTTGAGCAGCGTCTCTGCGTC
AAACGGTGCTAGGTTGAGCGCCTTCACCTCGGTTTGTGTGTCGTATCCGCTGAGTGCCTTGCTAACCTTGTGATCTTCTCTGCTTGTGTTGAAGATATAG
TTGAAGCCCTTGTTGATGGTGCTCATGTTCCAGGCGCCTCGGTCGAAGATCCAGCGTTGCGTCAGCCCGTCGCAGCCGTTCACGTGCTGTGCCCCGCCAC
GATGAAAGGAATGCGACGTGAGCGCTTCCGCAACACCAGCGGCAGCCATCACTCTATCCAGCAGCCGGTTCACGTGCGCGCAGATCGTCGGAGCAGTAGT
GTCGGTAGCGGCAGGCGCAGCGGAAGCAGCAAGGGTGGCGAAGTCTTCCGGGTTGTTCAGGATCTCCAGCAAATGCGTGGCGGGGGTCAAGTTGACAGCA
GCGGCGACTTGGACTTCAGGAAGATTGTCGATCAGGTCGTCACAGGGCGCGTCCTGCGTGATCAGCGCGACGGCGATGGCGTGTAGCGGGCAGCTGACGA
AGTCGGCGTCCGGGAAGAGAGACAACTCCTGCTCTTCGGCTATCTTCATGCGGATGAAGCGCATGAAGAACACCTCAGCCGCGTCGACCGACAGGTTCTG
TTTCCGGACGAGTGCCAAGTCGGACGCTCGTCCGAACAGGTACCACAGCAAACACAGCAACGCTGCGTCTTGATAGTCACTAGAGGAACGTGCATTGCTA
TACAAATACAACATCATCTTTTTTAAATCCTTCTTTGACCATGGTGGTGCTTTGTTCACTACTTTGCCGTCTTTTTTCATACAAAAGCTGTCGAGCGTCT
TCCCCATGCTTAGCATCTTTGCTTCGACAAAATGTCGCTGCACAGGGAAGACCTCGAACAACCACATTTTAGCCTGTCTAAAGTACTGCATAGTGGTATT
CCTGGAAGGAGAATTTCCTTTCTTACCCGCATTAAAGGCTAGATACATACCAAACATATCCAATACAGACACAAAGCACTTACCTGTAGCGTCCTGTTCA
ATGCATTGTTTGACATAGTCAAAGGCAATGTTCTCGCTTCTGACGAATGCATTGAACGCACTGATGGCGGTGTCTCTGGCACGCTTGGTGTTGCCAGGTT
TGAGCTCGTCCAACCCCATCCTGGTCGGATAAGACGGAGAGCTGGCAAATATGTAAGTGATATGTTAAATACTAGTTGTTTGCATTGCGATAGACATATT
TCCTAAGTCACTCCGACCCGATATGTCGGAACGGCTGGCTTAGAGGACATCCTACCTCTACTTGGATATGATTGGGTAAAATTAATTTGTAAGAACAGTT
AAATTGGTTATTTTCAATTAAAAATCGAGGATTGGCCAATGTTGATACATACATTTATAAGTACAGTCGGATAAGTTGTCATATTCATCCATATAGTGCA