Description :
From Genome Similarity Track
Location :
Scaffold_14:32448- 34752
Transcript NameFunction/comments
Sapdi_VS20SDRG_05274hypothetical protein
Sapdi_VS20SDRG_05275hypothetical protein
Sapdi_VS20SDRG_05276hypothetical protein

Sequence
2304 bases(100 bases per row)
AGCTCGGTAAAGTCCGGTTCGGATCCTCGCTCTCGGTCTTCGAACCGGTTAGCTGGTCTTATTTGAAATAGTGTGACTTGTTTGGGTTCAAATACACAGT
ATTTAAGGGAGAGGGAAAACACTATTTGTTGGCGATCCTGCCATGCAAGCAGCGACGGCGCGGGCCGCGGTCGACGAGTGCTATCGCCATTGCGACAAGC
TTCGGAAGGGTCATCATGCTGGTAGAGCCGAAGCCATAGGCTCATGAGGTGCGTAGGCTACCTGGACAAGGACGAGCTCAAGTGGGCCGTCACAGCCTTG
CTCGGCAGCACGCCCACCAAGGTGCGCTTGAATCGACGATCTTGCAGGCTGACGTATGGCATGTAGCTCGTGCTTTGCCAGATGTTCGAGGAGCTCCGAG
CTACGTACCCGGACGTCAAGGTGCCACGCGACCGGTTCATTTCAGTCATCTCGAGCCGCGTCCTGAACATCGACATCACCGAGACGCTGCGCCGCTGGTT
CATGGCCTTTGACTCCGCGTCGCAGGGCTACATAAACTTCGAGAGCTTCTCGAACGCTTGCGCCCAGGTCGTGCCGCACATGCGCCCCAGCGTCGTGCAC
GAGCTCTTCCGGGAGGCCGACACGAATAGCGACGGCAAGGTACGCCGACTCGAGTATACCCTGGCTACCATCCCTGGCACAGGTGACGTTCACTGACTTT
GAGCGCGTCATGCTCATCTCGATGACGCTGCCGCCTTGATGTGCATCAACAAAAGAGTGTATATCGATGATACGCTAAGTGGGAATGTCGGGCGGTGGTC
GCGTCGGGTACGTTCGCATGACGGTGGCAAAGTCGCCCTAGTACAAGGCATGAGCTCTGGGGCGTGCCGAGTGTATCGTACGGGCTTGATCTCGTGCTCG
CCCTGGTCGTTCTCTTCGCCGCACATGTTGAAGATGCGCATGATGGTGCGGTCGTCGCAGGTCGGATCGAACTTTTTGATCATCGCGCCAAACTCTACAG
AGCAACCCGGTCGCTTTTTGCTCGGCTGAACCAACAGACCTTGGTACGCGAGCACGCCGTTGCCGTCTTCGTCGGCTTGCGCAAACAATAGCGTGAGACT
CTCGTCGACGCTAAGTTCCAGATCGAATTGCACCACAGTGTCGTCGATTGTGGCGTGCGTACTGGGCTTGGTAGTCGTACCAGACCGTCATGACGCAGTC
CAGAACGTCGTCGAAACTGAGAAAGACGTGGTGCGGGTCCAGCACAAGCGCCTTGGAGGTGCGCTTCTTGGCTGGTCGCTCGCAGATGGACGGCAGCGCC
ACGATACGCGCCTCGAGGTCGGCGAGAAATACGACAGGTGTGTACGGAGGAAAGATCGCGTGCGCGAGGTCCTTGGCGATGTACAGTGGCACCTGCCCCA
CACAATAAGTACACAGATTTGTCCATAATGTTAGTTCGCACGTAAGTGGGTTTCGAACCGTCGCCCAAACGTGTTTCGATCTCGGGCGTTGGCATGAGCA
GCGTGAGCGCTTGCAGATACACGTCGATGGCCTGCGCGTTGTAGAGCTCGGGCGTCGCGCCGAGGAGGATCCCAAACCACTTGGCGCGCGAGCTATCCTT
CTCAATCTACCTCTACCTGAGATATACTGATACCTTGATACAAAACGACCTTTTTGACGCCAGCGACGAGACTGCCAATGCGCTTTTGGCTCGCCGACTT
GAGCCCGAGCTCCTGAATATAAAAGTCCTGGACGAGCTCCGCGAGCGAGACACGGTCGAGGCCCGAGTTGTCGTCGATCTGGTCACATAGAATTTTGCGC
ACGTAGAGCTTGGCGATCTCGCGTAGGACGTCCGGCCGCTCCATCGCCGCGCCGAGCCGTCGGCGCTTGACGATATTGCTCAAAATGTTGTGCCGCTTCT
TGAGTTTGGCGGTCGCGACCGTCGCTGCCGGTACAGCCATGTCTGTCCCAAGATGTGGGACGTCGCGCAGAAATCGCCGGTGTACCTGTCTGCGCCGCGC
TCGAGGCCATTTTCCGGAACGCAACGGGCGCCGAGTCGAGGTCTTCGAACCGGATGGCTTGCATGAGCTGTCGGTTCGTCGTGAGGAGCGACGAGATGAG
CGTCGGGTTCGCCTCCAACGGCTCCACGAGCAGGTCGGGAAAAGCCGCAAAGAGCGTCGAGAGCAGCCTCGGCTGCCGATGCGCAATGTCCACCAGCGTC
TCGGGGCTCTTCTCCAAATACTCGCTCAGCGCCTAAACCGTCGAAGGATCAACATCGATCCGCAACGTGCTCTACCTGGGGGCAGTGGGCTAAGATCGCA
CTGA