Description :
From Genome Similarity Track
Location :
contig_47:324431- 334072
Transcript NameFunction/comments
g9700.t1XP_009523408.1 hypothetical protein PHYSODRAFT_350602 [Phytophthora sojae
g9701.t1hypothetical protein
g9702.t1XP_008890438.1 hypothetical protein PPTG_00734 [Phytophthora parasitica INRA-310
g9703.t1XP_009523409.1 hypothetical protein PHYSODRAFT_354328 [Phytophthora sojae

Sequence
9641 bases(100 bases per row)
GATGCCTCGCTTGCTGGTACTGTACGGCAGCGAGACCGGCACGGCGCAGGACGTGGCCGAGTTCGTGCAGCAACGAGCCTTCAACCGGCAGCTGCTGGAC
ACGCAGATCTCGCCCATGGACGCGTTCCCCGTCTCGCGGCTGCTGCCGCAGTGTTCCACCGTCGTATTCGTGGTGTCCACGACAGGCGACGGCGAGGCAC
CCGAGAACATGCGCAACGCATGGCGCAGCCTGTTGCGCAAGACGCTGGGGCTGCAGTGGCTCTCGGGCGTCCGCGTCGCCGTCTTCGGACTGGGCGACTC
TAGTTACGCCAAGTACAATGCTGTGGCGCGGAAGCTGCAGGCTCGACTGCTGCAGTTGGGGGCGTCGGAGCTCATTGACCGAGGTCTCGGGGACGACCAG
CACGCCTATGGATACTTCGGGGCGCTGAACCCGTGGCTGGAGAAGCTCTGGGCGGCGGTGCTGCAATTGCATCCGCTGCTGGAAGGAGTCCCAATCGACG
ACTCACCGAAACCGGTCGAGCCTCTCTACGCTGTCACGGTGCATGAGGCTGGAGCTGAAGAGGTGGAGGCAGCTCGACTTTTGTCGCCGAGAACTGATGA
GTCCAACTTTTATGCGCCACCGCGCACCGTGGTGGGGAGGGAGAAGGGCATTTATTTGGCTCCTGTCGTGGTGAACAAGCGGGTCACAGCAGGTGACTGG
GAGCAGGATGTGAGGCACTTGGAGTTTGATATTCACAGTGACTCGAGTGGTGGGGGAGGGGCTGGGGCCCCGTTCAGAGCTGGTGATATTGCGGTGATAT
ACCCTGAGAACGTCACGGGAGTGGACAAGATGCTCAAGTATACAAACATGGATGGAGAGACGGTCATCTCGATTAACGCTGCTGATGGCTCGAAGCAGTT
CGACCTGCCATCCCCGATCACTGTCCGTGATGTGTTCGCAAAGTACTTGGCGATCCTGGAGATCCCGCGCCGGAGTTTCTTCGAGAGGCTGTCTCTGTTT
GCTACAAATGAAGAGGAGGTAAGGCATCTCGTTTACCCCGCATAGCGTGTGCTTGAAGATTCTAACTTTGTGTAAATCTGGGTGATGCAGAAAGAAAAGC
TCGAGGAGCTGGCCTCAGCCGATGGTGTAGATCTGCTCTATGACTACTGTATTCGTGAGAAGAAGACGTACGCCGAAGTGCTAACGGACTTCCCGAGCGT
GAACGTGCCTTTGACGATCCTGTTGCAGCTCATCCCTCGTCAGCAACCCCGTTCGTACTCCATTTCATCGTCGGCTCTGCTCCACCCTGGACGCGTAAGT
TGTTCGATAGGATTCCTTCGATCATCGTTTGCGTCATACTTATCGGGTGTCCATTTTGTAATGTTATACTAGGTGCACTTGACGGTGGCCATCGTCGACT
TCCTGACACCGTACAAGCGCCGCCGTAGCGGAATTTGCTCATCATTCTTCCAGTCGCTGGATCCGTCGAAGGAGCAAAAACTTGTGCCAATGTGGATCAA
GAGGGGTCTCTTTGAACCCCCCAGCTTAGAGCGCGATGTGCTTCTCATCGGCCCGGGGACAGGACTCGCTAGCATGCGCGCGATTGTGCAGGAGCGCCAA
TTCCTGCGTAAGCAAACTGTTGCCAGTACTGGCTCCGGGTCAACCTTCCTCTACTTCGGGTGCCGTCATGAACACAAGGTGAGAACGCGACTTCGTGTGC
TAAAAGTCCCTCACCCATTTAACGAATCGATTGTTGCGATGTAGGACTTCCTTTACGGAGACGAGCTGCGTGGGCTTGTGACTTCGGGTGATCTCACCGA
GCTACACACCGCATTCTCTCGTGATCAGGTGCTCACTACCGTTCAACTATTCTCGTAAACCCGGAAAGCTGATCAAACTAATCGTATCTCCGTCGTACTT
GCAGGACCATAAAATCTACGTGCAGACACGACTGGCCGAGAACAAGGATGCCATCTTCGACTTCATCATGAACGGCGAGGGATGCATCTACATTGCTGGA
TCCGCGAAACGAATGCCGAACGACGTGTACGAAGTACTGCGTGACATCGTTCGCTCAGTCGGGAAGATCCCCCTGCCAACCGCCGAGAAGGTGATGAAGA
CGTTGGCTCGCAAGAAGCGCTACGTCGTCGAATCTTGGTCGTAGAAACCTCATGCAGGCTAGATCAAACCAATTCAGTAGACTGCTTGGCCATCTCGGTG
CACTTCACCTTTTATGATTCGCTAAAAACACACAGACCATGTCCATGGACACCGCGCAGGAACTGGAGCAGGCGCAGCATGTGCGCACGTTCGTGAGGCT
CGCCAACCTCACGCAGACGCCTGAGCTGCACGAGTGGAACCTCGAATCCCTTCAGAGAGCTCTGCAGTGGGCTCAAGTAGCGGAAGATGTGGTGGATGGC
AGGGAGGGCATCGAATCGCACATCCGTCGGTGGTTCCCCGTGGCGACGCTGCCGACGCTGCCTTTGGATGGGGCTCTGACAGCCGACGCCTACGCCATGC
AAGCGTCCACTTGCTGCAGTCCATTCTGCAGAGCCCGTACATGGCGACGCATCCGACGCGGTCGGAACTGCTGGTGGCTGTGCTCCAGGAGCTCCAAAGC
AGACACGAAGACTCGTCGGCTGACGAGCTGGAAGAGCACTCTAACAGGTGACTTTGCTAGTGGCGCGGTGTGAGTGAGAGATCCTTATTTTGTTTTTTGA
TGTGCTGGTAGTACGTTGCTAACGGAGAGGGTTACTGGAGCCCCACGCGCAGACTCGATGCTAGCCATTGCTCGTCGAATGAGTGAGGCTTGCAAGCGCA
TTCGTGTGCAAGGTAATTGTCTCTGTCGCAATGTGGTGCAATGAGTGATACTGACGCGTTCGTGCAAATGAAGTGCTTTCTGGCTGGATCCTGGTGCCTC
CACTAAAGAGTTACGCACTATCACCACGCACGCTTCAGCTAAAGGCTATGGCGAAAACGTTGCAACGAAATGCAGTGGATGCTCGTGCGGCTGCCAACCC
CGAAACGTACCGAAAATTTCTCAATGACCTGCAAAGCTGTTTTGAAGTACTTGAAAGTAAAGATGTCCGGGTAAGCTTGCATGATGACTCTTTTTGTTGG
TGAAATGATTCTTATCAAAGAAATGATGTCATTTGCAGGAAGTTGTGGTGTTGATGCTGGTTATGTGCGAGTGGCCTGCGCAGGAACCTCCACAACTCCG
AGGAATGATGGAGGATCTTATGAAAATCGTGCGTGACTGGGTAATGTACAAGCCCATTCGGTACTGGACGTTCTCGCCGTGGTTGGCATCCATGCTGGCG
AACAAATCAGAAGCTCTCGCTCGTGCGTATGTAGTCGAGTTGTTCACGACAGGCCTTTTGCAACCATGTGAGATTGCAATTCATTGTCTGCACCAGTGAG
TCATCTATTGACTGTACATGTATTTTCTTACGCACTTTGCATTTACTTTAGGGGAGCGCGAGTTTGCAGAGCGTGTTGCACGCTGGTTTTGCAGGGTGAA
GGTGTGCAAGTCGTACTTGAACCAGCTTTGGCAAAGTTGGATCCCCATTTGCAGCAAACCTACTTCAAGGTAAATGCAAGCAAGTAGTTGCGACGGAATT
ATCTCTTAGTTCCATGCCGACGCAGAACATCGACGACATCGTGATGATTATTGCGGAGTGCTAGGTCGGTTGCAGTGGGGTAAGGCACTTGTAGGAGTGG
CAATGCAGTATCCGCGCCCTCGCCAATCAGTGCAGCACAGCAGTCTGCGAATCCTTCTTCTCCAGCGATCAGCACTGCAGTATATCCGAAGCGATTACGT
TGGTTGATCAGTGACCGAGTCCATACTTCGTCGAGGTATGACGATTGGCGAAGGTGGCGCAGTATCAGCTGCAGGGAAATTAGCGCGTTGGATGCAGTTG
CAATATGTAGAACTGAATTCCCATCGGCATCCGTCACAAGAACTCCTGCTCCATGGCTAGCGTATATTGATAGCTCTAGTTAGTAAATCTGTCCGAGACA
AGTTCATCGTACGAACACTTACTGAAGAAGGTAGCTGGCAACATCGTGTGCATCCCAAGCGCATGCATACTGCAGAGCTGTGCGACCCGTGTGATGCCGT
TCGTCCAGCAGTGTCGGATTGTCGGTATAAAGAATGGCAAGAGCACAAACATCGTTGTTCCAACGGCTTCCATCCACTGGTCCAGGAGCTCCATCTGATC
AGTCGCGTGAAAATAATGATCAATTTATTAGGAAGGCACTACATAGTGCATGGCCCGGCATATTTGGTCGATACAACATCAGTCAGTGGTGAAGCCGTAC
ACCTCGGTCTCCAGCACCGCGTACAGCACAGCCTTCAACTCGTCGCGAACAACGTGCAGTGGCAGGTCCAAACGATTGAAACAAGCGTGGCTGTGAATGA
ACCCGTCACCAATCAGCGACACGGCCTTCAGTGTAAACGGGCACAGACGACCATCGTAGCTCGTCAACGCACTGAACCCTCCGAGAGGAACGCGCGATGA
ACCAGTTGAAAACTGCAGCAGCCGACGACGATACTCATTTGGCATCTCTCGCACTAGCTCCCAGAACCACTTGAGTGAGCGGTGGTGGTGAAGGTCTTCC
GAATACTTTGTGTTGCGCTCCCAGTCATCTACGTCGATCTCGTCGGAGCCGCACAGCAGGAAGTCGAACTCTTCCGGGTCGAATAGCAGGAGAAGTTCGC
GAGGGACGATTTCGTACAGGCCCTGCAAGAAGACTTGCAGTTGAGGGGCCACACTTTCCACAAGCAGGTATTGCCACTTGAGCTCCACGAACTCGCGCTT
GTTGGAATCGGTGACGGGAATGGCACTGCCGCCAGGCACGAGCTCGATATCGCGATAGCTATCTCCATCCTTGGTAGTCACGGTGAAATCGAGATCTAGC
GCATCGACATTGTCGTTCTCCAGTAACCAACGCAAATTGCTGTACACCTCTGGGTCCAAGTCCTCCAAATCTTCAAAACTTAACGGGTACCCAGAATCAG
CTTGAGGAGAGGTGAACCAAGTGGAAGCACAGCATAGAACCTTCGAGCAGTGCGCGACCCAGGAGACGGCCGGCCGCATACAAATGCAGGAGTCGATCCG
GCAAAAGATCCATGTTTGAGCAGGGGCTCAAAAAGTAGGCTTGCTCATTTTTGTTGGCATATACAAAGAGACCGCGAGCAGGATCCACGAGCATCTCGTT
CAGCATCACGAACCACTCGCGATGAAGTCCTCCCGCATCCACTCCACTTTCATCCAGGAAATTAATCCGAAGCACAGAGTGGAGGTTTCGTAAGGGGATA
ATGGCGAGGGACTCCATAGAGTCCTCGAACACATTGGCACGCTCCACATTAAGCCTCAAATGCTCTCTCTCCGCTGGAACCAAGAGTGTTGACGTGGCGG
TAACGAAATGCGCATACTTCGAGGGGAAGTCTTTGCTTGCGAGAGCTATAGTCTCGCTCGGCGGCGGCGATGTCGTTGTGGTCTCACGTAAGCTGCTATT
TGGCGCATTTAATTCTGCGCTTCGAGGTCCAATCTCAATTTCCAGGGGCAGTTTCGAAGCGTCCACAGTGGTGTCAGAGGCTGTCGTGAGTACTGTGTGC
GTTGCTTGGGAATTGTGTACCAAGTTGGTAATGCATTCTTCCACAGATCCGAGCAATGGTTCCTGCTCTCGTATGCTGTCCGTCCAAGCGTATTCGCGTT
CTCTGCTGCAGCCAGTTCGTGTTCTGGTTCGGGTTCGGCCGCATCCGTTCCAACAGAAGATGCCGTTTCCGTATTGTCAAAGGCAATTCGTGATGGTGCA
GCCGGTAGCAGTGGTGAACCATTATCTCTAAGAAGGACAGTTGATAGCTCTTCCGACACGGATTCTTTATCACCTTCACACGTCGTCGCTCCTTGTTGAA
GCAATGGCAAAGCATCAATCCCATTGGACTCACCACAAGTAGACAGGAACTTGACAACAAATCCCGTGAATCGCGTGTCCGTCCATCGTCCATCACGGAA
CCAGAACGTGCGTCCTTCAACGTCCACTTTCCTCGTCCACTCTTTGCGTCGCTGTGCCCGTAGTCGACGTCGAGTCGTTTGGTGCGTCGGCGTAGCCGTG
ACCAACTGCACGCGACTCTCTCGCTTGAACAGCGGCAAGAACGATAGTCTCGGTGCCTTCTTGTCTCCGTTTTGCTGTTCGTCGTCCGCGAGCGCCTGTC
CGCACACGGTGCAGAACTTGACACGTCTGAAGTTCTCGAAGCTGCAGACTGCGCAAACGTTGAATCCCTCCTCCGCGTCTCTCAATGCCGCGTCCAGTCG
TCGATCGTCAGAGCTGCAGCAATTGCAAAGTTAGTGTAACTGGGGCCTCAACGGAAGAGCAACGACGCACTTGAGCAGCGGCGCGTGCAGCTCCAGCGAC
CGCTGGCGACGGATGTAGGCGCGTCTCGCTAACAGCGACAAGCAGCAGAAGAGCAGCGCGATGACTGCCAGCACAGCGAGGAAGCCCACCACGGCCTGCA
TGTCGTCTCCGGATGAATCTGAGTGTGGCGTGCGTCAAGCATCTGCGATCGATTACCGAACTGGTAGATGCAAAAGTGTTTGTCATGGGTATAGTTTAGA
TAGATTATAAGAAATGAATAAAGAGGAGAGGAGAGACTTTTGAGGAGTACTGTTGTGTCCAGGTAGCGGTACAGCAGATGAGTGTTGAGCTGCGGGCACC
GTACACCGAACGCCGACCGTGCTGATCAACAGGATGTTGCTACATGGCAGGAGCTAGGAAGGCACAGGGCAATGTATATCGCACTCACTTACTTAATATC
ACTCTAGTCTGCACCCAATAAACTTCACTAATCGGTTGTAAACCCGTACACCTCGGTCTCCAGCACCGCGTACAGCACAGCCTTCAACTCGTCGCGAACA
ACGTGCAGTGGCAGGTCCAAACGATTGAAACAAGCGTGGCTGTGAATGAACCCGTCACCAATCAGCGACACGGCCTTCAGTGTAAACGGGCACAGACGAC
CATCGTAGCTCGTCAACGCACTGAACCCTCCGAGAGGAACGCGCGATGAACCAGTTGAAAACTGCAGCAGCCGACGACGATACTCATTTGGCATCTCTCG
CACTAGCTCCCAGAACCACTTGAGTGAGCGGTGGTGGTGAAGGTCTTCCGAATACTTTGTGTTGCGCTCCCAGTCATCTACGTCGATCTCGTCGGAGCCG
CACAGCAGGAAGTCGAACTCTTCCGGGTCGAATAGCAGGAGAAGTTCGCGAGGGACGATTTCGTACAGGCCCTGCAAGAAGACTTGCAGTTGAGGGGCCA
CACTTTCCACAAGCAGGTATTGCCACTTGAGCTCCACGAACTCGCGCTTGTTGGAATCGGTGACGGGAATGGCACTGCCGCCAGGCACGAGCTCGATATC
GCGATAGCTATCTCCATCCTTGGTAGTCACGGTGAAATCGAGATCTAGCGCATCGACATTGTCGTTCTCCAGTAACCAACGCAAATTGCTGTACACCTCT
GGGTCCAAGTCCTCCAAATCTTCAAAACTTAACGGGTAGCCCAGGATCAGCTTCAAAAACGGCGAGGCCAAGTGGAAGCACAGCATAGAGCCCTCCAGGA
GTGCACGTCCCAAGAGACGACCAGCCGCGAAGAGATTTAGCAGCTGGTTAGGAAGTAGCTCCATATCCGAGCAGGGGCTCATGTAGTATGTCTGATCACG
CTTGTTAGCACAAACAAAGAGCCCACGTACTGGATCCACAAGCGCCTCATTGAGCATCACAAACCACTCACGTTGAAGACCCCCAGCGTCCACACCGTTC
TCATCGAGGAAGTTTATGCGCACTACAGAACGAGCATTCTGGAGCGGGATGATAGCGAGGGACTCCATCGAGTCTTTGAACACGCTGGCACGCTCAACGT
TGAGCCGTAGATGCTCTCTTTCAGCTGGAACCAGTAGGGCTGAAGCAGCCATGACGAAATGTGCATACTTGGAGGGAAAATCTTTACTAGCGAGCGCCAT
TGCCAGGGGTGGTGGTGATGCATTGCCTAGGACAGTATCGGTTCCCAATGCTGTACGAATTGGACTGTTCGGCAGAGTGAGAGGAAGTCTTGTGGCATCC
ATATCAGCGTCAGCTGCTGATGTGAACACAGAGTGCATCTCCTGTGCGTAGTTTACCAAGCTTGCAGCGCACTCCGCAACCGATCTGACCATAGGTCTTG
GCGACATTGCTCGATTTGCCGCATATTCTTTGTTTCCCTCGGTGTGTTCTAGTTCGGGATCTGGTTCTGAGCTACTCCGGCTCGTTGAAGCATGAGCTTC
AGGTGATTTTCCGTCCACGGCAATTCGACTGTTTGCAGGCTTGAACTCAACAACAAAGCCTGTTGCAGGTGTATCAGCCCCAACATTGTGGCTGTCACGA
AACCAATATGGGCGTCCTTCGACATCAAGTTTGCGTGTCCACTCCTTGCGTCTCTGTGCCCGTACACGGCGGCGAGTGGCTTGCTTCGAGGATATCGAAA
GTGCAGTGGACGAGGTCGTCTGCGTTCCCGTATGTCGCTTGAAAGTCGACAACATTCTCGTCAACCTTCTCCTCTCGCCCTTGTTGCGCGACGGCGAGCG
GCACGAGAAAGGTGCCTTCTCCACAATCGGCTCGCCACAAAGCGTGCAAAAGCGGACACGCTTGAAGTTCTCAAACGCACAGAAGTCGCACACGATGAAC
CCTTCCTCCGCATCTCTTCACACACAATATAGCGTCAGCTCTGCCAGCCTCCCTTTAATTGAACGGAGACAAACCTTAGTGCCGCATCCAGACGTCGATC
ATCGGAGCTGCACCCAACCAAATGGACAGCAGATAGCCGTTAGATACAGCAACCACACGCAGAATACCCGGACGAAAGCAGATAGCCTCTAGCCTCCGTT
ATGGTCAACTGCATGTGCACGTACTCGATGAGTGGCGTATTCAGCTCCACCTCGCGCTCGAACTTCTTGAACGAACGTCGTGCCAGCCACGCGAAGAAGA
GTGCGAAGAGCAGGGCGATCCCACACGCCACACCGATGGTCACGCCCACAGACATCACTCGGTGGCGTCCTTGAGAAGGGCGAGAAGTTGGAGAGTGTCA
GTGACACTGTGTCACGCTGGAACAGGTGCATTGCACACTTCGATCAGATGCCGATCAAAATTATGATGAAACACAGAAGTGTTCACCTTACACAGTGAAT
TAGTGGGGTACAAACTGATTTGTGGTTTTACAGTAGAAGGTATCGAATCAAAGTTTTCAGACCGCGTCAGTTTGCGGTTGTGGCTGTTGTGTACAGTGAC
AGAAATCTCCAAAGCAAAATGCACTGGCGAAAAGGTCCCTTACGTGTAGCCAACGCACTATTTAACCGGTTGAAGCACGCGTGACTGTCGATGTACTTAT
CGCCCTCTCAGCGAAAATGCACACAGCCATCTATCGTAGTGCACCGCAGCCACCGAGCGGTATCCACAGGACGAACCCGTTGAAAACTGCAGCAATCGGC
GTCATACTCGTTGGGTATTCCACGCGCCAGCTCACAGAGCAGCGACGTGGTGCAACAAGTTCGAGTAGTCGTTCACGTCGAGCCACACAGCGGAAGTCAA
ATTCTTCCGGGTCCAAGCAAGTCGCGAGGAATGATTTCGTA