Description :
From Genome Similarity Track
Location :
Scaffold_64:32440- 33768
Transcript NameFunction/comments
g9777.t1KUF78486.1 Cytochrome P450 86A2 [Phytophthora nicotianae
g9778.t1hypothetical protein

Sequence
1328 bases(100 bases per row)
CTGGTGAATTTATTCACGGCCAGAGCCCTGCGGGACCACATGACGCCCATCGTGCAAAAGTGCGCGTTGGCGCTGCAACGGGTGTTCGCTCAGGCGGCCA
CGAGCGGAGAAGCTATCGACGTGCACCATGTCATGGGCAAGTTCACGCTGGAAACGTTTGCCGAGATCGAGTTCGGCAGTCAGTTGGGGCTGCTGGAGTC
CGGCCAAGAGCACGCGTTCGAGACGGCCATTGACGACGCCAACCACATCTCGCTCGAGCGGTTTGCGGTGCCCATGTGGGTCTGGAAGCTCAAGCGCTGG
CTCAACGTGGGCTCGGAGCGTCGTCTTCGAGAGGATATGGCCGTGATCTCCAGCTTTGTCATGAGCTGCATCTCCGGGGCGATGGAGCGTCGCAAGCAGC
GACAGGAAGCTGCAGCTCGCGGAGAACCACTGGGACCTGTCGCCAAGGACATCGTGTCTATCTTGCTGGACAGTGAGGACACGATCGGCGAGCCCGTGCT
TCCTAAAGACGTGTTCAACATCTCCCTGGCTGGAGTCTTGGCTGGTAAAGACACGACTGGAGACGCCACGAGCTGGCTCATGCATATGCTGCATGAGAAC
CCGCGAGTGGAGAACAAGCTGAGAACAATACTGCTGGCTGAAGTGCCCAAGCTGGCGGTGGACGAGAGCTACGTGCCCTCGATGGAGGAACTGGATGGTG
TGACGTACTTGGAGGCCACGATTCGTGAAAGTCTGAGGCTGAAGCCTCCAGCTCCGTGCGTCACGCAGCACTGCACACAAGACACGGTGTTCCCGGATGG
CACCTTCGTCTCCAAGGGCACGGACACGACTCTGCTGTATCACGCTTCGGCGCTGCTACCGAGTGTCTGGGGTCCGGACGCTGCAGAGTTCAAGCCCGAG
AGGTTCCTGGATGAGAACGACAAGCTCCTCGTTCTGCCGCCGCTCAAATTCATCGCGTTCAGTGCGGGCCCACGCAAATGCGTCGGCCGCAAGCTCGCCA
TGATCGAGATGAAGGTCGTGACGGCGTGTCTGCTGAGCCGCTTCCACCTCGTCCAAGTGCCTGGCCAGGACATCCGCGGCACCATGGGCATCAGCCTCGG
CATGAAGTACGGCATGAAGGTGAACGTACAGAGAACGCCTGGCGTCGCCATTCGAGCCTGAAGTTGCAGGAACCTCGTTCTTGCTCGCTTTCCAATGTAC
ATCATCACTTCCAGCGGCTCGTTCGCTACAATAACACTCGGTTGAATCCAATAAACATGTATATTCCTTACGCTATTTTGCAGTTCCTGCATTCATTTTC
CAGTGTACGTATCCCATTAATCAAGTTC