Description :
From Genome Similarity Track
Location :
Scaffold_2633:3244- 4639
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2633-snap-gene-0.2Myosin class II heavy chain (ISS)

Sequence
1395 bases(100 bases per row)
GTGAACGCACCCTCGGTCACGGTACAGAGTTTCCCACAATGTTATCGTAATTTGACGCATTCATTTGGCAGGTTCAGTCAGTAAGGTCGGAATCGAAGAT
ATACATCACCCAGTTTCTGGAGACCGTGTCGAGGTGAGCCATACGAATCCACTAATGGAGTTTGGACGTGCGCTCTCAAATCTGGTGGTGCGCGCAATTC
TTCTTCTTAGGCTGGAACAACGTGTTGATGATCTGGAACACGCGGTACGTAAGCTCGCCAACACTTGGGCTCCACAAACGCGCACCTCATCTGCTTTTCA
AACATAGAACGATAAAATCCACGTTACCGTGCCAACAATGGCAGCATATCAGACGCCACGACAAAGGGATAGTGAACGAACCGACCGTAATGGCGAAAGT
CAAGTGAACGACATTGCGCAGATCACCGAGGCTGTGACACGAACCTTGGAGAAGGTTAGCTGTGCCGAAGAAGTCACCCCGCTGGAGTGCGCCTGACTCT
CGTTTGCTGGCTAGCAACTCTCCACGATGGTATCGACGATCCGGGCGGATGTAGCGCATCACGCAGCGCTCGAAAATGAAATGAGACCGCAGATTCAGTC
ACTCGAAGATCGGCTTGTGAAGAGTGCCCTGCGAGCTGAAGAACGCAGCGCAATATTCGCCGAGCGAGATCAAAGAGAGTGTGGGGCTTCGAGGAGAGAC
AAGCCTGCCAGATTGTCCTTACAATCAAGATCATCCTCGTCATCGTCATCCACGCAAGAGAAGTCGGTAAAGCGACCATTGGTCAAGTCGGCCCATGCTG
TAACTCCGCAAACCCGTCCGGTGAGCATATTACAATCATTACAGAACTGCGATCTGGCATCTCTCTGATCAATCCACGTTACTTAGAGTACAAGAAAGGC
CAAGGCGACTGATGCACCGACAAGCAAAGGCAAATCAAACCGACTGAAGGAGGTTTGAAGGGTTACTTACTCCTACGGAATTATGAGGCTCCCCGGTCAC
TCATCAAACGCCCGGTGTATTCTGTAGCTGTGTCTCGACCTGGTTGCAATGGAAGGATCACTCAAAACTAGGCGGAAAGGAGTTAACAGGGCCACTTCAT
GAAAGTCGTTGCGTGTCGCGTTCCATTGCGATACCCAGGGCGATTGTGTCTTGAAGGTACTTTGCAGCGTCAACTCCGATTACGATGTGGTAGTCCTAAA
CAAACACAACTCCGTGGTCACCACTGAAGACCACGTCCGTCCAAGCACGGATAAAGGCACCTCAAGTATCCGCATGATCCGGTCAGCAGCTTCGTATCGC
TCTTTCACTATTGTGCTGATCTGTCGCCTGCTTTGTCGAGAAAGCGGTTTTTGGAAGCCCCAGTGATTCAAAGCTCCTGGTCATATTGACATGTA