Description :
From Genome Similarity Track
Location :
Scaffold_52:324388- 328804
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16374animal Inward Rectifier K Channel (IRK-C) family
Phypa_INRA-310PPTG_16375hypothetical protein

Sequence
4416 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCAGTGTTTAAAGCTGTAAAAACTGACATTAAGTCTCGTAATCGCAGTCGTTCGCTGGAATCATTCTGGACTCTGTATGCATTGGCA
TCTTTTACGCGCGCTTCTCCCGTGCCAACGTACGTATCTCTTTCCTTCTGTAAAGAGTTACTGCAGAAACTTACCTTCGTTCTTTCCCTAGCAACGGGCG
AATACCATCATGTTCTCGAACTCCGCCGTGATTCGTAAGATTCGTGGGCATTATTACTTCATGTTCCAGACGTGTGAGCGACGGAAACACCAACTTGTGG
AGGCCCACGTTCGTCTCTATGCTGTTCGACATGAAGCAGAGGATGACGCTGATGAGCCCAACGACTTTCTTTTCCAGTGCCACCAGATGCGAGTGCAACA
GCCGGATGACGACTGCGGCGCGATGCTTCTTATGGTGTTACCGCAGGTGGTTGTGCATCGTATTGATCAGTGGAGTCCGCTATTCCCACCTGAGTGTCTG
CCACGAGACGGTGGAGATCCAAAGACATGCGCGAGTTATCCGGACCCGACGCAGCGGCAAGTGGATATTGACAACGGGAGTCGCGATGGAGGACTGCCAG
GCGATCCGAAACTGTACAAGGAGCCGACGAAGATGCAGATCATGAACCACATCCGCAAGAGTGGACTGGAAGTCGTCGTGATCTTGGAGGGTATCGACAG
CTCGACGTCCAACACCATGCAGGCGCGCAACTCTTACACTGACGAAGACATCGCGTGGGATGCCACATTTGAACGCTGTGTGATCAAGACGTCGAGAGGT
CTCTGCATTGACTTTGATCGCTTCCACCTGCTGAAGCCCGCGCCACTCGATGCAAAGCGTTGCGTCATGTCGTCGCAATTCTGAGAATATTGTTGTGAAA
GCAGCAATTTTTCGCGGCAACAGTATGAGAGTGTAATGACAACAATGTAGATCACTAGTTTGATGTTTTTCTCGTTTGATATCATTGTCAAACTGTGTGC
GTCATAGTCGCAGAGTTAGTTATACTACAGCCAAGTCGTAGGCAATAAATATCATGCTAACAAACATTCACAAGCATCTACCGCTTGGCAGTGGTACTTC
GCCTCACGTCTGGCGCTGACGATTTTGTCGGCGAAGTCTTCTCTTGAGCAAATTGGCATCTGAATGGCACCACAACGAATTGTTAACCCCATTAGCTCAA
CAACCCTGATGAGTCAGCTCGATCGTACCGTTGATTCGACGTTCTTCTGCTTCAATGTCAGATCGGTCACGTGCAATTGCCAGCGAGAAAGCTCGAAGAG
GGATTAATGGCTTGGGTTCAACGCTCTCTGTAGCGGCCTGGGGGTAATCTGTAGCATCTAACCAACAACGGTTAGGAATTAGACGATCTAAGGTCAGGTA
ACTATACAATCACCGTCTTACCAGATTTTACACGACCACTAGAAGACTGTTCGCCACCACAAGCATTAAAATTGAATCCAGTCACCACAGCCGACGTGTT
CTCATTGAAACTCATCATCGCCTCCGACTCACGCTTCTTCAGTGAAGCCACCTCGCTCTCCAGCGCACGCTTCTCCTCCTCGAACGCTGTCACCACCGAA
CACTGTTGAACCTGGAGCTCCTCTAGCTGCATACTCTGAGCCGACAAACGCTCCTCCAAAGCACACTTCTCGTTCCGAAGAGCATTCATCTCGTCACCTG
CCTCGGCATTCGACGCCTCCAACTTGGCTCTCGCAGCTTCAAGCTGCTCCGACAACGAAGACAGCTCGCTCTCTAGCTGACCCACTCGATTCTTTGTTTC
AAGTGTTGGTTGAATTGGTGGCGAGGATTGGCTATGCTGGCTTTTCAATTCCTCTAGCTCGTCTTCTTGACTCGCAAGTTGCTCAGCAAGCTTGTATTGA
ATCTCTTGTTGCGTCGCTGTGTCTTGGGCATGGGCATCCATGGTTGCAGCCATCGCATCCTTGTACCTTGATTCACTTATCTGTTTTTCCTCATCCATCA
TCTGAATTCGCTCATGGAGTTGTTGCAGTTCCTGGGCTTGGGTTTGTAATTGTTTGACGAGCAATTCGTTTTCCGCATGGAGCTGAGCAAAATCGCCTTC
CGAATATGTTGACGTTTGTTGCTGGATTGCGGTCTCAGACTGCACTGTAGCGGGCGCTGTTTGTGGTGGGGTCGGGATTTTTGACGGCATGCTGCCTTCA
GGAGTTTTCTTCAACGCAGACGTTGGTGTCGTAGGAATTCGGCTTGGCAGAGGAATTCCACTCGCAGGGGTTAGAGCATATTTTCGCTGCAATGGCACTG
GAGTTGTCAGTACGTTCGTGTCTGCGGTTGGTGGCGTCATCTTCTTGTCGGCGGAGCCACGCGGCTTCATGCTTGATTTTGCTCGAGATTTTAATCGCCG
GTTTGGTTGCCTAAAAGATTTGTTCGCGCGTGCTGTCGCGTCTCCAGTACTCAAGTTTTTAGTCGCATTTTCCAGGGAAATCGTGTTCGTAATTGTCGCT
AGATGTCTGCGCTTTGCAGGCTGATGATGCAACACACAAAAGAATCATCAGTAAAAAAAAACTATTAAGAACCAAACATGCAAAACGGAGTACCTGGTGT
GATTTGCCCAAGCCAGCTTCGTTATGAGATCGCTTCAAATGTTTCTTGACCGCATCGGCTAGCAAACCATTTATCCTAGAAGCATTCAGCGTGTTCTGCA
ATCAGAAATCATATTTCCTTTAAATGAGTAGCAACAAAATTGTACCTGTCCGCTTGATCGGGCCAGATCGCGATATATTTCCTGCTCACCAGCGAAGTTG
CTTGTTAGCCAGTGAGACCTCAGTAAACCAACGTTCAAAGCGTAATTACCAGTAGCAATCACGAGCCTTTTCACGTCCTCTGGGCGACGCATCGCTTAGT
GAGGTCTACATACACAAGCACCAACACTAAGCAACAAAAGTCACTTTGCTACACTTAATCAAATTAATCTTACCGCGATAGCCGACTGGAGAGGTATCCT
AAACCTTTCCAGGACAGCGCTATTCCAGCCTTCGAGAGCCAAATATATGTAATGAATGCAGCTCTCTCTCACCTCGCGATTCCTAAAGCCACCAAATCCA
ACAATAAATCAGTTCC