Description :
From Genome Similarity Track
Location :
contig_31:324209- 325585
Transcript NameFunction/comments
g6100.t1hypothetical protein

Sequence
1376 bases(100 bases per row)
AGCTGACATTGATCCGTACGTGCATAGTGATGTGGCCACCGTCCGCCGCACGCGGGATCCACAGCAGCAATGACCCGCCACCTGAGCCTGGCAAGCCGAG
CAAGCCAGGCCGCCACCGATCGAGGTACATGTTCTTGTCTTGTAGCTCAGGGACGGTGGAGTCCCAAACCACCGTCTCACCTGCGCCGACGTCCACTTCG
GCATAGTCTTCTCCACCCGTATGAATGACCACCGTCACATCCTCCTTATCCGTGCTTTCAAAGATAAGACGAACGACTCCGTCACCCGCCTTGGTCCACG
ATCCGTAACTACCTTCGAACGCCTCATCCACAGTCATGAGACCCAGCGCATCGTATAGAGTGCCATCGTCGATCTCGCCAAGGTAGGCGGTGGGTCCACA
AATGGGCTGCACGAATTGAGACGCCAAGTACGCGATCCCTGTGGGGTCGACCGTTGAGAGCACGACGAGGCCCATGTTCGAGACTTCGAGCAAATACTCG
TCTTCCGCGACGGATGCCCCCATATCTGTCGTAGCCTTCTCAATCAGCTGGTCAATAATCACACTGAACGTTCTCCGGAGTAGATCACGCGTCTCGTAGG
CTGCCGAGATGGTCTTCGTGGTTAGCAACTCGGCCATACAGTTGTTGGTAACCGCAGGAATGTCATTTAGCACAGTGGGGGACTTGTACACCGTCACTCG
AATGTCATTGACGGCAGCGTTGGGTGTGTCATTGCGAACGTCGTTGACAGCGTAGACGACGCGATCTGCGAGACGCTTGAGCTCCCAGCCACACGTTGAA
TTCTTATCGATGAGGTCCTGAAGTTCGTCCGTCGTCGTAGACGAATCGTTCAGTGCACCACTACCTGTGAGCATGTTCAGCACATTCCCCCCGTCGACAG
GATTTCATCACCATTTGTGATGGCTTGCTTCACGATGCCTTCTACGACCGTCACCACCATGTCGATATACTGGGCCTTCTTCGGGACAGGCAGGCCAAGG
CAAGCACACACGGCGACAGGCAAATCAATCAGCACGACATCAGACTGGTAAGCCACCGCCAGCAGCTCCTCTGTGTCTCCTTGGGGCGCTGTGGTTTGCT
GGTAGCGGATATAGAAAATGAGAGACCGCACCACCGAGATGACGTTGGCGGCGCACGTGATGGCCCACTTGGCAGTTTTGTAGGCAGCTAGAATTTCTCC
AAACACGTTCAAAGTGGCGATATTAAACGCCACAGCCACGACGGAGCCAACTTTCCAGATAATCTCGAGAGCACAGTCGTCATTTTGAGGAATGCACTCC
GCGAAACATCTCACAGATATGATAACGGGCACTGCGCTAAGCAGTCATCGTCGTCGTTGCCGTAGCCTATTGGGCA