Description :
From Genome Similarity Track
Location :
Scaffold_2379:3242- 4999
Sequence
1757 bases(100 bases per row)
NNNNNNNNNTGTGTACTGGTCCAGAACGCACAGCAATCAAGAGCCACCAGCGATGACGTTGTGTTTTCCCATTGGCCAGGTCGTGAACGCTGAATTAGTC
GCAGAAGAACGCAAGCGTGAGCTGGATAAGCTCAAATTCAGCAGGTAAGTTTCGTGTTGTGACTGGCCAGTCGATATCAGTTTCTTTCCTCACCAATGCC
GCAAGCAAGTTTCTTCGTTACCAGGAACTGGATGTTGAGATTGAAGAATGCCACCGCGAGATCGAACGGCTACGATCACAGCTGAGCCAGTACACGATTG
TCGGTAAACTCAAGATTTCCAGGCGGTCGACAAGCGCAGACGGCCCAAAGCCTTCTCTATCGAAGCCTAAGCGACTCGTCCAAGAAAATCAAGGCAACCC
AGTTCTCCAGTATCGAGAGCAAGTTGTGGCACCGATCGCTGCTCCAAGTGCGAAACCCGTTGAGCCGCGTCAGTCAGCCAAGCGAGAAAGCTTTGTGGAG
CGAACGCGACGTCGTGCGGTGGAAGCCGAGTACCAAAAGCAAGTGCGGCTCGCGCAACTCGAAGCGGAGTGTGAACTGGAAGAAAACCTGCGGATCTTGG
CCAAGCGTGAAGCAGCAGCGCAGGCTGAAATGCGACGCCAGAAGAAAATCCAGGAAGGCCAAAGAGGGAAGCGAACGGAACGCGTTGATGTTACGCCCGT
TGCGGATCCACCAGCGGAGATCAAGGACGAGCCACTGATTGCGGCTGAGATGGCGGCGACGTCGGTGGAAAGCGAAGTTAGTTGTCCTCTTCAGGTCACA
GCGAGTGCTGCGACAGCACAGGCGGACGTAATCGAGGTGCCAGCGGACGTTCTTGTGGCGGTGGACGGACTCGTTGCAGACGTGATCGAACAGGCGGAGC
AGTCTGAGCTGCACCATGATCAGCCAAAACAATACGACGACGACGGCTTTGATGATGGTGCTGAAGACGACAACGATCCTGTCGATGCATCCAAAACACC
AGCGCAGAGGGATGACAGCAAGGAAGGGAACGTGTCAGCAGACGACGACGACATGGATATCGAGGAAGTCGAGGAGGGCGTCGGTTCGACTGTAGAGTCT
GGCAAACCGTCCGTGGCCGTGGGCGAGGTGTTCGATGACGAAGAAGAAGACGTGGAGATCGAATCGAAGGAGGGACCGGAGAAAGAGGCAGAGGCGGAAA
TAGTATCAGCACCTGGAAGTCCCGTCGACGACGCTTCTTCACAGGAAGGTCAGGATGTAGAGCAAGAGGCTCGGCAAGTGGAGACGACGCAAGGATTCCT
TCTGGATCCAGTCAACCCTGTCGATGTGCCGTGTTCTCCGTGGTCAGAGACCACCGCTGCTTACACCATAGAGAACGAACAAGGCGCTGAGGAGGTCACA
ACGCCTGAGACTGAAGAGGTGTCGGGGGCAGTAGCTGGTGCCGAGTCCGCTGAGGATGAAGAAAATGGTGTTGGAGAAGACAATTACGAAGAGGCTAAGG
CTCATGACGATGAAGAAACTCAAGCTGAATATCCGTCAGTCGAAGAAGGCCAGGACGNNNNNNNNNNCAAGGCTCATGGCGATGAACAAACTCAAGCTGA
AGATCCATCAGTCGAAGAAGGCCAGGACGCTGAGGTCAAAGATGCTGGAGGCCAAGGAGCAGTGGTTACGGCTGACACTATTCATCCCCCGGGAAAGCAA
GAACCAATAGCTTTGGAGCCCTCATCCCTCGACGACACAGCCGAACGCATCTCCGCG