Description :
From Genome Similarity Track
Location :
Scaffold_241:32416- 33756
Transcript NameFunction/comments
g15820.t1KUF87744.1 Poly(A) RNA polymerase protein 2 [Phytophthora nicotianae

Sequence
1340 bases(100 bases per row)
TCCTTGCAGGAGCTGGTCCGCTCGCTTTGGCCTGATGCTATCATTGATATTTACGGGTCAAGCTACACGCGTCTAGCATTACCCGCAAGTGATATTGATT
GCGTCCTGGTTTCGAGGACGTTGGCAGGAGAGCGGCCTTTGACGATTTTGGAAGCACTGGCGGCAGAAGTGGAGCGTCAGCCTTGGACGAAGAAACTGGA
ACTGCTTGGAAGTGCAAAAATCCCCGTTCTCAAGATGACCTATTCCCTCGACCCGACGCAGCAAGATGTCCTGCTCGATCTTACGTGTGGCCATTCCGTT
GGCCACACTGGACTGGGCGCCCGTGATCTTATTTATTCGTTCCAAGCGGAGATGCCAGCCTTGCGCCCTCTGGTGCTGATTTTGAAAAGCCACCTCGTCA
GCAACGGTAATACTGCTCTTGCCCGGCCATACGTGGTGTACAGTCACTAACTCTCGTCTTGTAAATCGTTTTGTGGATGCAGATTTGAACTGTGCGTTCT
CCGGTGGTATCTCATCGTACGTCTTGGTCATTCTGGTGATTCGCTTTTTGCAGGTACGTTATCGCATCTGATTCTACATGTTGGCTGGGGATTGTTTTCT
TACGAATGCGCTTTATTTACCGGTGTTAAAGGCATGTGGTGATACCCACCACAAGTCATTCGCGAGCACCGACGATCGCAAAATGAAAGGAGGAGGTAGA
AGAAGAAGTTACTCGGAAAACACGTCAGCCCCCGAGTTGCCAGAGGAGATGGTGTACACTCCAAGCATCACCGACACCGTGTTGCAGCCGAAGTGGTGTT
ACACGTTTTACCGTGGCGGACGAGTTACGTGGCGCACTGGCATCGGAAGCCTTCTGATTCTCTTCCTGGAAACGTACATCACGTTTGATTATCGCCGGTT
CGGTGTCTCCATCGACAAGGAAGGGTTAGTAAGCGATATCTGGAGTGCTACTGCGGTTGTTATGGACGTTTAACGTTATCGCATCTTGTTGCTGTCTGTA
GGGAGTATTTTCTGCTTCCGCCGGATAAAGTGACCCCAATGCAGTGCTCCGCCGTCATCCCGTACGTCTCTGATCCAATCAAACCCGGACGAAGCATTTG
CAACTGCTTCCGCATGCACGAGGTAAGATTACTACCGACCAGAATCATGTGCCTCTGTGGAAGATTGGATCTAACGAAGGGTGGCTTTTTGTGTGTAGGT
TACCCAATCGTGGCTTGCATTGTACCAGAACTTGGCGGCTGGAGTTCCCGTGGCAGTGTGCGTGGGAAATGGCTCAAGCCGTTGAGCCATCGGAGTCCCA
AGCATCGCATCCAAGAACGAGCTTCTCGAGGTGTGAGCGC