Description :
From Genome Similarity Track
Location :
Scaffold_31:324135- 329064
Sequence
4929 bases(100 bases per row)
AACCAAATCGATGTTAGATTTTTTTTGTTATAACAGCCTTGAAAATTACTATACCTCCTCAGAAACACTTTCACGATCCGCACGTGTCAGAACTTTCCGA
GTAAGCCCCATATCAAAGTGATGAACACGGCAAATTGTTGAAGAGGATACCCATCGGGGTGTTCTTCTTGTAGGTACGTCTGCAGTCCTTCAACATAGAA
AACAAGATGCATTTTCACATACTTGTGAATGTCAGCAACAACCTCTGGTGGTTATCTTGAACTACGAGACGGCTCCACATGTTCATCAATGAGGCCGTTC
TCCAAGAAAAGGCTGTACCAGCAAAATTTCGTGTTAGGATTAGGTCCAAAGGTGTCGCTGATGAAGTTCACGTTGTTGCCGTACACGGGCAGCAGCGATA
CTGCACGCCAGCGAAAATCAGCCGAGTAGGTCATGGCAACAATGCAATTGCTGCGCTGAGGTTCTGTCCTCTGTCTTAGCGGCGGGAAAATCTGAAATGC
ACTGGTGGTTGTGCTATTTGGGCGCGTGTGTGAAAAGCCAACATGGCAGCTACGGCCGAGATCAACATACGACGCGCTGTTGGACTACTTTGTTGTATTC
AGCGTGTGCCACAGCTGGGTTTTCGACCAAGGGATCAAATTTTAAAACGCGATGATCCGAGCGAGGAATTTCCATAAATCAGTGATTTTTCACTGATATT
TGACAAAATGATAGTGATAGCTTAAAACTACTTACTCAGTGCTTTGGTAAAAAGTAATAATTCAGTAGTATTTGTGCAGCCTGGTGGGCATCCGTTACTC
TATGAGTCGTCAATATACTAGAAGTAGTCACCATATCACAATATTTACAGTTGCATAACTGTAACCCGCTGTTTCGTAGCTCTTTTTCCAAGTAGTTCGC
AAAGCTATTTGCTAACGATCAGGGCTAAGAAAGCCCAAATAATCACTGGTGTTCTATCTGAAATAATTTACTGGACATCGCATTTTTTGCGCAATATGAA
ATACCAGTACGAACAGTATTTGCTGTCATGAGCATGCGCAAGTTGCTGCAACACTGTATAATATCATCCTCAACGAGGTGTTTACACGAACTGCATTTAT
TTTTTTTGGTAAGATGTCTCTATTTCCAAACTACATTTATTCTGAGATAGCAGTAAGGCTGCTAGCGCAGCCCAAATCCGATCATTTGAAGCCGATCAGA
TGAAGCCTCCCTTTAAAGTTAGGTTTTAACTATTTAGAGGGTTCTAGACTCAGAAATTAAGATAAAGGAATTGATGAAGGTGAAGATCTCACATCAGAAT
CTCTTACTCAACTCCAAAAGCCCAATCTCGTTCAACTCGAACGCGGTTCATTCCTTAGTTTGCAGGAGAAGGCTATCCTATTGCTACTTTGTCGCTTTAA
TAGGACTGGGTACTTGGCTTCACATAACCTTGTCTAATGAAGATAACCTATTTTATCTAAAGCTATTATGGATGCATGGAAGCCAAATGACAACTTTATT
TTAGAGAATTCACCATCTCCTGGGTCCGTTGAGCTTATACACTTTGTTCTATCGCGAAAAAGCTGGGTTATGTCGGCGGAAGGGCAGATGCAAAACAATA
GTGGAGAAGCTTAGACCCTTGCATTTTGTTGAGTCCTCAAGACGACCAACGAATAAAGTTTCTTCAATAAAGTAGTCAATATTAGTGCAGAATAACAGAC
AAGTTGTATAGTGCAAAAAGCATAACCACCAAGCACTACTATTTTATATAGTATTTTTGTAGAAGGTAACACGCTACCTACGTGCACTGTTTGTAGTATT
ACTATAGTTTCAAATTTGACTTGAAAATTGTATGGATGTGCTAGTACTATAGTACTATACCTCCGTCAGTGAATTCAGGCAAACTGTCACAACAATTTTG
TCAAATCTCAGTGAAAATCACTGATTTATGGAAATTCCTCTGATCCGAGCATAAATACGCACCCTAGGAGCCCATTATCATTCCGCGGCCGGAAGATGCC
TAATGACAAAAGTACTGCGCTGTTACCGTGCTCTACTGCCGGAGTGGCGACTGCAGAGATCGATAGACCTCGCGTGATCTAAACCGTGCAACTAGTTCTT
TTTTTCTTTTTATGCATCGTCGCCAGCATCTCTGGAGGTGGGTGGCGCCTGTCACGGCGATGATAGGTATCGCATCCATGAACCCCATCAATTGGACCAA
CGCACCGAGATCGCTTTAATTCGCGGTGCTAACTTCGAGGATGTGAAGAAGCTAGAGAATCTACACATGCAGCTCGCAACGGCAAAGCAAACGATAAGAA
GCAAGGGCGAACAAAAGTGGGAAAACGCTGCCAATATGGTCCAGTTTGCAATTGGAGACTACAGATACTATGTAGATGCGTGGAGACGTCGTCGGTCGAA
GCTCCGCGCCAAATAGTGTGGCCCACTCGACCGGTAAACACTACCCCGGATTGGGTGTTCGAATCGGAAACCTCCCGACTCGCGGAACCAGAGAAGCCCA
CGTAAGTAAGCTGAAGTTTTACACCGGGCTTTCATAAAGAATAGACCCGTCATTTTAGAAGGTTCTATCGTGGCTTGTACGCATTTAGCCGTCAAATCCA
GTTAGATCGAAAAATAACAATGAATATATAAACAGACCAGCACCCATAATCGATCCTCCTAGCAGAGCCTGATAGACTGAATGCATGTATATGTACCTTA
TAACTAGCAGCAGGTATTTTTCCTGGGCTCGAAGTGCCAATTCAAACGGAATTTCCAGTAATCTGACGCTAGATCAATCCTGAAGTAAAAAGCTGGTCAA
AGCTCAGCCATCAAATCAGGGTTAATGTCAAGATGATGTGCTCGTTTTGTTATTATATCCACTGTGCTTTGCATCTATTTTGACCAAACAGAATAACAAA
ACTCTGTTTAAAAGTCTGTATTAGATCAACGATCTCTGAAATAGACTCATGATTACGAGTTATAAATTTTAGTTACAAAGTGTCAGGTCGAGATTAAAGA
GGCACACGTTCGAAACGAGTACATACTTGCCACCGCTAACTCCGGTACCTTATACAAGGACTCCTGATGGGGTTGTTCGTTTGGTCGCTCAGCACCAGCA
GCTGGACTGGAAAATTGCCGTAGTCAGCGGGTACCCCATGGACCCGGTCAGTGGGGTTTGATGCAGTGCTCGCCCCGAGTGCTATCGACGGTAACCACAA
AAAAACAATACACAAAATAGAGATCTGGGGAAATGGTGGCTCATCGGATACATTGTGTGTATTGGAGGCACCGCGCAACAACCTGCCTTGGAACCGCCTT
CATATCAGACAAGGTGTATTTCGACACAATGTTTGTCGGCTGTGCACCTCAAAAATGACCAATGATGCAAATCTGGAGCTAAGTTCCGGGGCACCAAAAG
GTTACCACACTCGGTCCACGTTATCACCCAAGACTTGATCGTCGCCGAGCTTCAAATCTGCTGGAATATCCACGGCCACCGATTGAACTACTATTACCCA
CTCCTGTGTTGACCATTGAAAAACCGAATCACGGGGGGGGGGGGTCTGCAAGTGATATGAGCAGCTGCCGTGGTGAAATATAACCCTCAGCTAGACAAAA
GGTCATGCCAGCCGTTCGAGTCACCGGGATGGCTTGGCTTTCATACATCCGCAAAAGTGACCAGCGATGAAGCTTGTCAGCTTGTCCGCAAACTGCCAAG
GATATGGTCGTGGACGCAAAAAATGGAGCGCAAGCTTCTGTGATTAGTATATAGACTGAATCCAGTGGGTCGACGAACTAAATAGCCAGCACACTTGGAG
GTCTTCACTATCACAAATGTATCTTTTTTTCACGATCTCCTGCGTTTGGCTCCACCCAAAATGCGCCTCTGACATCATTAGCCGTTTGTGACACCGAGCT
CCAAAATTATGTTGAAGTCGTGCGGCGCGTGGGTTAACGCGGCGCTCCAGTGTTCGTCGCTTGTATCAGCGAACTCGCACAAGCGCTTATCAGGATCGGG
GTGGCCCAACGTATAATGCAATGCGTTAGTATATCACGGAAATCGTCATTTATGATTTGGGGTAGTTTACGAGTCGGATTACGGAAGATTAAGGGATATT
TTACGGGGAGTTCCCTATTTAGTTTTCTGGACATTGTCCCATCAACTAAATTACATGTCGCAACGGGTGGACATGAAATGAGTAGCTAGTCGAGGATACA
AGACCATTTGGGAGACGGTGGACATCTTCAGCCGCGCTATTAACGAGTCGTTTGCGACTTCTCACCCAAGCTTGCTCACGTTCCTTGCCGTGATCAAGAC
CAAGTTCAAAATTATGTTTTCTGCCACTTGTGACCGATCGCGTTTACAGTAATACGCAATAACATACTAATGAGCGCGCCGGAGGAAGACACGGTCATTT
TTGTTGCAATTGGACAAACGCTAGCTGAGTTACAAACAAAAACGCTAGCACGGGGTGGCGAAAAGGGTAATGACGAAAGATCATACTGCGTGTTTCGATG
ACGCTTTGCCTTATAACTCTGCGAAGGTTATTGTGCAATGTTTCGTAGCTTACCGGTTGCTTAGTATAACAAGGTTTTATAGAGTGTTTTTGAGGTGGAC
CAATTCCGATAGAGAGCATTCATTCACTGACTTTCCGCTTGTAATACTGTTAACAGATCGGCCTATTAACGTTGAACTGCAAGCTTTGGGTACTAGCGAT
TTTTAAGGGGTTTACATCAAATGTTGATTTGTTGGCCAATCTCGCCAATCTGTTATATTTAATTTAATGTGCTTGACGTCAGGATTGAAGGAATATCACA
GCTACAGCTACAACATCAGCAACAACTCGTCGTCAGAAACCGACTCAACACCTACTTCCTCGCAAGTGCTACCAAATCGCAGCTTAGACTGAGCTCGCGT
TAGCGTGAACTCAGCCTAATTCTGTGACA