Description :
From Genome Similarity Track
Location :
Scaffold_8:32412- 34995
Transcript NameFunction/comments
Phyta_totarag565hypothetical protein

Sequence
2583 bases(100 bases per row)
GTCTTCGGGACACTCGTGTACTGGATGTGTGGCTTCATCACGGAGGCAGGATACTATCTGCTGTTCTTGCTCTGTATGATCCTGACCAATCTCGCACTAT
GCGCGTGgttcttcacgctgacgGCCATGTCGCCAAATTTCAACATCGCCAAACCCATCTCCACGTTCTACGTCGTCTTTGCAGGATTCGTGGTGCCCAA
GAACCAACTTCCCGGTTTTCTCGTCTGGATCTACTGGATAAACCCGGTTTCTTGGTGTTTGCGGACGCCAGCTGTGAGTCAATATCGTTCACCAAAGTTC
GACGCGTGCGTGTACGATGGCGAAGACTACTGCTCACAATACAACATGACCATGGGCGAGTATTCGCTGTCTCTGTACGATGTACCCTCCGGCACGTTGT
GGGTTTGGACCGAAGTGTTGTACTTGGCATCCTCAATTGTTTTCTTCGTGGTAGTCGGAAGCTTCATCCTCGAGTACAAGCGCTACGACGTCCCTGAACT
TACAGTAGCAGTTGTTGCAAGCATCGACGAACATAAGCAGAGTATGAAAGAACCTCGGCCGACCAAGGAACAACGCGAAGACATTACCAGTTATGTCGAG
GTCGTaacaccacgagcagcatcTAATGCGCCAGCATCACAAGATAGCCCAACGAACATGATAGTCGtggatctccagcagcaggcaagGTTCGTTCCAG
TCACATTGGCCTTCAAAGATCTTTGGTATTCCGTGCCCGTGCCTCACCACAAACACGAGACCATCGATCTGCTCCAGGGGATCAGTGGGTACGCGTTACT
GGGAACAATGACGGCACTCATGGGATCGTCTGGTGCTGGTAAAACGACATTGATGGACGTGATCGCCGGCCGCAAGACAGGAGGCACCATCAAGGGTGAT
ATTCTGCTGAACGGCTATCCTGCGACGGAGCTCGCGATCCGCCGGTGCACCGGGtactgcgagcagcaggataTCCATTCGGAAGGAGCCACAATCTGAG
AGGCGCTCACCTTCAGCGCTTTCCTTCGCCAAGATAGTAAAGTGCCAGAACTTGCCAAACTCGCGTCTGTCGAAGAGTGTTTGGACCTGCTGGATATGCG
CACCATAGCCGACCAGATCATCCGTGGTCGCTCAcaggagcagatgaagcgcttgacCATTGGCGTAGAActtgcagcacagcacagtGTGCTGAACCTA
CGACTGGGCTAGACGCTCACTGTGCCAAGGTCATCATGGACGGTGTACGCAAGGTGGCTGACAGCGGCCGCACCGTCGTGTGCACGATCCATCAACCGTC
ATTGGACGTCTTTTTCCTGTTCGacagtctgctgctgctgaagcgcggCGGAGAGATGGTTTTCTTCGGTGAGCTGGACAATGCACAGCCGGACGATCGG
GAGTGTGGGCATTTCATCGACTACTTCGAGGCTATTCCGGAGGTTGCTTGTTTACCCGAGGGTCAAAACCCGGCgacgtggatgctggagTGCGTTGATG
CAGGTGTTGCTGGTTCGGGTGAGAAGCCGATGACAATCGCTGCTTCGAATGTAGACTTTGTGCAGCATTTCCGTGAGAGTacggagctggcggctcTTCT
GCGTGGTCTTGACCAGCCAGGCGTAACAAGACCAGCTCCTGACAAGTTGCCCGAGTTGATATTCACGAGCAAGCGTGCCGCCAGCCAGTTAACACAGCTA
CGCATGCTGATTGATCGGTTCTTGACCATCTACTGGCGCACGCCCTCGTACAACCTGACGCGCTTCACGATAGCATACGGCCTTGCTGTGGTATTGGGCT
GGTGCTTGTCAACGGTGAATACACGACGTACCAAGGAATCAACTCGGCAGTAGGCGTAATCTTCATGACCGCGTTGTATCAAAAGCTTCTTACGTCGGGT
GCCTGCCATTCACAGCTAAGGAGCGCGTCTCGTAGTACCGCGAGCGAGACCCACAGACGTACAGTGCCCTTTGGTACTTCGTCGGTGCTACCGTTGCAGA
GATCCCGTTCGTGTTTGCTAGTGGCCTCATCTTCACGGTCATCTTCTGCCCTCTGATGGGCGTCGGGTCGTTTGGAACTGCAGTGCTCTACTGGATCAAC
GTCTCACTTTTCGTGCTGATGGAGACGTATTTGGGCCAAATGTTTATCTACGCGCTGCCGActgtggaggtggcggcggtcATGGGCGTGCTCATCAACG
CCATCTTCCTGCTGTTTGCGGGCTTCAATCCACCTGCGGGCTCCATCCCGACCGGGTACATCTGGGTCTACTACCTCACGCCTCACCGATACTCGACGGC
TATCCTCATCGCGCTCTTATTCGGTGACTGCCTCGTGGATCCGACGtatgatgaagcagcagagtcGTACAGTAACGTTGGCTCTCAAGTTGGCTGCCAA
CCGCTGCAGAATGCTCCGCTGTCTATCGGTCACACCACAGTGAAGGAGTACATTGCAGACGTCTTCAAGATCAAGCACGACGACATCTGGAGCAACTTCG
GCTACGTTTTCCTCTACATCGCCGCCATCCGCGTGATTTCGCTTCTGTCGCTCCGATACCTCAATCACCAGAAGCGGTAAGCT