Description :
From Genome Similarity Track
Location :
Scaffold_36:324108- 325162
Transcript NameFunction/comments
g3890.t1hypothetical protein

Sequence
1054 bases(100 bases per row)
TTCATCGTGAAGGAACAGTGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGAGTGGAGTCATTGAAACTCCACGTAAGCAGCTACG
TTGGAAGAGAGGGGGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGC
CATGTCATGTCTTGGCGGACGAGCAAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTC
AAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGTGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAG
CACGGTACTTGGTCTCGAACATCGTGACCAACCCGATCGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGTCTTAGAGATGGGCCTGTGAAGACCTA
TCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTCGCAATACAAGAAGAGTTTAGCGTGCGGCAGGCTAAACTGCATGTGAACGTCCCG
CGGCTGATGCCACGACCGGTGGTACGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACGGCTGCTGGTTCCCAGCAGCGTCGTGGATCAA
CGAATGTGCGTTGTTTTCGCTGCGGAAACATCGGTCACTACGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGTGATACTGGGTA
TCGTCACGGGCAATCAAAAAACTAGAGGGACCAGCAGGTGCGGGGCGCCCTGCTGGTGATGCGGTCGAGCGTGTCGACATCGGACACGCTGCAATGAAGA
TCGCTGCGCCCAGTGAGAGTCAATATCACTGCAAGAAACAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCG
TGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTTC