Description :
From Genome Similarity Track
Location :
Scaffold_93:3241- 4597
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh-piw_contig_93-abinit-gene-0.56Carbohydrate-binding protein

Sequence
1356 bases(100 bases per row)
CTCGCTTGGTCCTCGCTCATACGGGTTCCGCTGAGCACCTCCAGCAAACTGCTGCTGGTTGTTATTGAAGCCCTGCTGCTGCTGCAATGGCATTGCGCTG
TTGTTGTTGAACGAGCGCTCAGCCTTGTTATCGAACGGCGTCGTGGACTCCATGCGCGCGTACGGCGGGTTATTGTGATTGCTGTTGTTGTTGCCGTGTT
CGAGGTTGATCACATCATCTGCAGATGACGAGCGCGCCCTGTCCTTGTTCTTGCACCCGCGCACGATCTTGTGGATGATCGTGTACGCCTGGCGCAGGAA
GAGCAGGAAGAAGATGAACATATTGACGCCGATGATGCCGTAGGCCACGTTGTCGCGCACCTCCTGCGGGAAGTAGTCATCCTGCACGAGCATGAGCATC
ATGCACACGAGCACGATCTTCATGAACACCGACGTGATGCCGATGTAGTACAGAAAGCGAAGCAGGTTCGGCTCGCGCGCCAGCAGCAGCACCAGGTACA
GCACGGTGATGCCGAGGATGCAGAGCAGCTGCGTCGTCGAGTCCTGGACCACGCCCACGACGGCGCCCGTGGACACTGCGAGCAGGATGCGGGGCACGAA
GAAGAACCGGTTCTCAAAGTTGTACTCGTCGTAGTACGCGCCGTACTTGGCGCTGAACGGGCGGTTGTCGTGGGCGATCGTGCCAATGTCCTCGAGCTCC
TCCTTGTTCTTCGAGACGATGAGCACGCCGAAGAGGATAGCAAAGCCCACCATGACGATGAGGCCGATCGTGCCCCAGATATAGTACGAGTCGCGGTCGC
TGCTACCGGCGTTCTGGTACACGTAAAAGCTCCCGGCCATGCTGAAGATGTACTGCGCGAGCAGGAGCGCGAGGATGCACGCCCAGATCACCTTCCGGTA
CAGCTTCGCGGCGACTTGACCAACCGACTCCTTCTTGCTGCACATGGAGAAGACGACGACGCCGATGACGAAGAGCACGTGGATGACGCCGAGCACGATC
GCGAAGCTCAACAGCGTGTAGAAGAACAGGTTCTTGGGCTCGACGCCGATAAGCGCGGCGTACCGCTTGGGCCCCGTCTCACCGCTCGCGGTCGTCGAGA
GCAGGCTCGAGTCGAGGCGGCGAGTGGACTTGGCCAGGTCTGTGATGGACTTGGGCACGTTGAAGTTGGTCCACGCCATCTCGCGCGAGAACTGGTGCAG
GAACACGGGCGCGCCGTCGATCTGCAGCTGCGTGATCATACCGATGAACTGCGCCTGCTCGATGATGTGCGTGACCTCGTAGAAGCCGCTGGAGAAGCTC
ATGACGGATGCCGCGGACGGGAAGAACGACGCCCAGAGCATCGAGGCCACGCCCGC