Description :
From Genome Similarity Track
Location :
contig_47:324027- 333663
Transcript NameFunction/comments
g7886.t1hypothetical protein PHYSODRAFT_350602
g7887.t1hypothetical protein

Sequence
9636 bases(100 bases per row)
GATGCCTCGCTTGCTGGTACTGTACGGCAGCGAGACCGGCACGGCGCAGGACGTGGCCGAGTTCGTGCAGCAACGAGCCTTCAACCGGCAGCTGCTGGAC
ACGCAGATCTCGCCCATGGACGCGTTCCCCGTCTCGCGGCTGCTGCCGCAGTGTTCCACCGTCGTATTCGTGGTGTCCACGACAGGCGACGGCGAGGCAC
CCGAGAACATGCGCAACGCATGGCGCAGCCTGTTGCGCAAGACGCTGGGGCTGCAGTGGCTCTCGGGCGTCCGCGTCGCCGTCTTCGGACTGGGCGACTC
TAGTTACGCCAAGTACAATGCTGTGGCGCGGAAGCTGCAGGCTCGACTGCTGCAGTTGGGGGCGTCGGAGCTCATTGACCGAGGTCTCGGGGACGACCAG
CACGCCTATGGATACTTCGGGGCGCTGAACCCGTGGCTGGAGAAGCTCTGGGCGGCGGTGCTGCAATTGCATCCGCTGCTGGAAGGAGTCCCAATCGACG
ACTCACCGAAACCGGTCGAGCCTCTCTACGCTGTCACGGTGCATGAGGCTGGAGCTGAAGAGGTGGAGGCAGCTCGACTTTTGTCGCCGAGAACTGATGA
GTCCAACTTTTATGCGCCACCGCGCACCGTGGTGGGGAGGGAGAAGGGCATTTATTTGGCTCCTGTCGTGGTGAACAAGCGGGTCACAGCAGGTGACTGG
GAGCAGGATGTGAGGCACTTGGAGTTTGATATTCACAGTGACTCGAGTGGTGGGGGAGGGGCTGGGGCCCCGTTCAGAGCTGGTGATATTGCGGTGATAT
ACCCTGAGAACGTCACGGGAGTGGACAAGATGCTCAAGTATACAAACATGGATGGAGAGACGGTCATCTCGATTAACGCTGCTGATGGCTCGAAGCAGTT
CGACCTGCCATCCCCGATCACTGTCCGTGATGTGTTCGCAAAGTACTTGGCGATCCTGGAGATCCCGCGCCGGAGTTTCTTCGAGAGGCTGTCTCTGTTT
GCTACAAATGAAGAGGAGGTAAGGCATCTCGTTTACCCCGCATAGCGTGTGCTTGAAGATTCTAACTTTGTGTAAATCTGGGTGATGCAGAAAGAAAAGC
TCGAGGAGCTGGCCTCAGCCGATGGTGTAGATCTGCTCTATGACTACTGTATTCGTGAGAAGAAGACGTACGCCGAAGTGCTAACGGACTTCCCGAGCGT
GAACGTGCCTTTGACGATCCTGTTGCAGCTCATCCCTCGTCAGCAACCCCGTTCGTACTCCATTTCATCGTCGGCTCTGCTCCACCCTGGACGCGTAAGT
TGTTCGATAGGATTCCTTCGATCATCGTTTGCGTCATACTTATCGGGTGTCCATTTTGTAATGTTATACTAGGTGCACTTGACGGTGGCCATCGTCGACT
TCCTGACACCGTACAAGCGCCGCCGTAGCGGAATTTGCTCATCATTCTTCCAGTCGCTGGATCCGTCGAAGGAGCAAAAACTTGTGCCAATGTGGATCAA
GAGGGGTCTCTTTGAACCCCCCAGCTTAGAGCGCGATGTGCTTCTCATCGGCCCGGGGACAGGACTCGCTAGCATGCGCGCGATTGTGCAGGAGCGCCAA
TTCCTGCGTAAGCAAACTGTTGCCAGTACTGGCTCCGGGTCAACCTTCCTCTACTTCGGGTGCCGTCATGAACACAAGGTGAGAACGCGATTCGTGTGCT
AAAAGTCCCTCACCCATTTAACGAATCGATTGTTGCGATGTAGGACTTCCTTTACGGAGACGAGCTGCGTGGGCTTGTGACTTCGGGTGATCTCACCGAG
CTACACACCGCATTCTCTCGTGATCAGGTGCTCACTACCGTTCAACTATTCTCGTAAACCCGGAAAGCTGATCAAACTAATCGTATCTCCGTCGTACTTG
CAGGACCATAAAATCTACGTGCAGACACGACTGGCCGAGAACAAGGATGCCATCTTCGACTTCATCATGAACGGCGAGGGATGCATCTACATTGCTGGAT
CCGCGAAACGAATGCCGAACGACGTGTACGAAGTACTGCGTGACATCGTTCGCTCAGTCGGGAAGATCCCCCTGCCAACCGCCGAGAAGGTGATGAAGAC
GTTGGCTCGCAAGAAGCGCTACGTCGTCGAATCTTGGTCGTAGAAACCTCATGCAGGCTAGATCAAACCAATTCAGTAGACTGCTTGGCCATCTCGGTGC
ACTTCACCTTTTATGATTCGCTAAAAACACACAGACCATGTCCATGGACACCGCGCAGGAACTGGAGCAGGCGCAGCATGTGCGCACGTTCGTGAGGCTC
GCCAACCTCACGCAGACGCCTGAGCTGCACGAGTGGAACCTCGAATCCCTTCAGAGAGCTCTGCAGTGGGCTCAAGTAGCGGAAGATGTGGTGGATGGCA
GGGAGGGCATCGAATCGCACATCCGTCGGTGGTTCCCCGTGGCGACGCTGCCGACGCTGCCTTTGGATGGGGCTCTGACAGCCGACGCCTACGCCATGCA
AGCGTCCACTTGCTGCAGTCCATTCTGCAGAGCCCGTACATGGCGACGCATCCGACGCGGTCGGAACTGCTGGTGGCTGTGCTCCAGGAGCTCCAAAGCA
GACACGAAGACTCGTCGGCTGACGAGCTGGAAGAGCACTCTAACAGGTGACTTTGCTAGTGGCGCGGTGTGAGTGAGAGATCCTTATTTTGTTTTTTGAT
GTGCTGGTAGTACGTTGCTAACGGAGAGGGTTACTGGAGCCCCACGCGCAGACTCGATGCTAGCCATTGCTCGTCGAATGAGTGAGGCTTGCAAGCGCAT
TCGTGTGCAAGGTAATTGTCTCTGTCGCAATGTGGTGCAATGAGTGATACTGACGCGTTCGTGCAAATGAAGTGCTTTCTGGCTGGATCCTGGTGCCTCC
ACTAAAGAGTTACGCACTATCACCACGCACGCTTCAGCTAAAGGCTATGGCGAAAACGTTGCAACGAAATGCAGTGGATGCTCGTGCGGCTGCCAACCCC
GAAACGTACCGAAAATTTCTCAATGACCTGCAAAGCTGTTTTGAAGTACTTGAAAGTAAAGATGTCCGGGTAAGCTTGCATGATGACTCTTTTTGTTGGT
GAAATGATTCTTATCAAAGAAATGATGTCATTTGCAGGAAGTTGTGGTGTTGATGCTGGTTATGTGCGAGTGGCCTGCGCAGGAACCTCCACAACTCCGA
GGAATGATGGAGGATCTTATGAAAATCGTGCGTGACTGGGTAATGTACAAGCCCATTCGGTACTGGACGTTCTCGCCGTGGTTGGCATCCATGCTGGCGA
ACAAATCAGAAGCTCTCGCTCGTGCGTATGTAGTCGAGTTGTTCACGACAGGCCTTTTGCAACCATGTGAGATTGCAATTCATTGTCTGCACCAGTGAGT
CATCTATTGACTGTACATGTATTTTCTTACGCACTTTGCAATTTACTTTAGGGGAGCGCGAGTTTGCAGAGCGTGTTGCACGCTGGTTTTGCAGGGTGAA
GGTGTGCAAGTCGTACTTGAACCAGCTTTGGCAAAGTTGGATCCCCATTTGCAGCAAACCTACTTCAAGGTAAATGCAAGCAAGTAGTTGCGACGGAATT
ATCTCTTAGTTCCATGCCGACGCAGAACATCGACGACATCGTGATGATTATTGCGGAGTGCTAGGTCGGTTGCAGTGGGGTAAGGCACTTGTAGGAGTGG
CAATGCAGTATCCGCGCCCTCGCCAATCAGTGCAGCACAGCAGTCTGCGAATCCTTCTTCTCCAGCGATCAGCACTGCAGTATATCCGAAGCGATTACGT
TGGTTGATCAGTGACCGAGTCCATACTTCGTCGAGGTATGACGATTGGCGAAGGTGGCGCAGTATCAGCTGCAGGGAAATTAGCGCGTTGGATGCAGTTG
CAATATGTAGAACTGAATTCCCATCGGCATCCGTCACAAGAACTCCTGCTCCATGGCTAGCGTATATTGATAGCTCTAGTTAGTAAATCTGTCCGAGACA
AGTTCATCGTACGAACACTTACTGAAGAAGGTAGCTGGCAACATCGTGTGCATCCCAAGCGCATGCATACTGCAGAGCTGTGCGACCCGTGTGATGCCGT
TCGTCCAGCAGTGTCGGATTGTCGGTATAAAGAATGGCAAGAGCACAAACATCGTTGTTCCAACGGCTTCCATCCACTGGTCCAGGAGCTCCATCTGATC
AGTCGCGTGAAAATAATGATCAATTTATTAGGAAGGCACTACATAGTGCATGGCCCGGCATATTTGGTCGATACAACATCAGTCAGTGGTGAAGCCGTAC
ACCTCGGTCTCCAGCACCGCGTACAGCACAGCCTTCAACTCGTCGCGAACAACGTGCAGTGGCAGGTCCAAACGATTGAAACAAGCGTGGCTGTGAATGA
ACCCGTCACCAATCAGCGACACGGCCTTCAGTGTAAACGGGCACAGACGACCATCGTAGCTCGTCAACGCACTGAACCCTCCGAGAGGAACGCGCGATGA
ACCAGTTGAAAACTGCAGCAGCCGACGACGATACTCATTTGGCATCTCTCGCACTAGCTCCCAGAACCACTTGAGTGAGCGGTGGTGGTGAAGGTCTTCC
GAATACTTTGTGTTGCGCTCCCAGTCATCTACGTCGATCTCGTCGGAGCCGCACAGCAGGAAGTCGAACTCTTCCGGGTCGAATAGCAGGAGAAGTTCGC
GAGGGACGATTTCGTACAGGCCCTGCAAGAAGACTTGCAGTTGAGGGGCCACACTTTCCACAAGCAGGTATTGCCACTTGAGCTCCACGAACTCGCGCTT
GTTGGAATCGGTGACGGGAATGGCACTGCCGCCAGGCACGAGCTCGATATCGCGATAGCTATCTCCATCCTTGGTAGTCACGGTGAAATCGAGATCTAGC
GCATCGACATTGTCGTTCTCCAGTAACCAACGCAAATTGCTGTACACCTCTGGGTCCAAGTCCTCCAAATCTTCAAAACTTAACGGGTACCCAGAATCAG
CTTGAGGAGAGGTGAACCAAGTGGAAGCACAGCATAGAACCTTCGAGCAGTGCGCGACCCAGGAGACGGCCGGCCGCATACAAATGCAGGAGTCGATCCG
GCAAAAGATCCATGTTTGAGCAGGGGCTCAAAAAGTAGGCTTGCTCATTTTTGTTGGCATATACAAAGAGACCGCGAGCAGGATCCACGAGCATCTCGTT
CAGCATCACGAACCACTCGCGATGAAGTCCTCCCGCATCCACTCCACTTTCATCCAGGAAATTAATCCGAAGCACAGAGTGGAGGTTTCGTAAGGGGATA
ATGGCGAGGGACTCCATAGAGTCCTCGAACACATTGGCACGCTCCACATTAAGCCTCAAATGCTCTCTCTCCGCTGGAACCAAGAGTGTTGACGTGGCGG
TAACGAAATGCGCATACTTCGAGGGGAAGTCTTTGCTTGCGAGAGCTATAGTCTCGCTCGGCGGCGGCGATGTCGTTGTGGTCTCACGTAAGCTGCTATT
TGGCGCATTTAATTCTGCGCTTCGAGGTCCAATCTCAATTTCCAGGGGCAGTTTCGAAGCGTCCACAGTGGTGTCAGAGCTGTCGTGAGTACTGTGTGCG
TTGCTTGGGAATTGTGTACCAAGTTGGTAATGCATTCTTCCACAGATCCGAGCAATGGTTCCTGCTCTCGTATGCTGTCCGTCCAAGCGTATTCGCGTTC
TCTGCTGCAGCCAGTTCGTGTTCTGGTTCGGGTTCGGCCGCATCCGTTCCAACAGAAGATGCCGTTTCCGTATTGTCAAAGGCAATTCGTGATGGTGCAG
CCGGTAGCAGTGGTGAACCATTATCTCTAAGAAGGACAGTTGATAGCTCTTCCGACACGGATTCTTTATCACCTTCACACGTCGTCGCTCCTTGTTGAAG
CAATGGCAAAGCATCAATCCCATTGGACTCACCACAAGTAGACAGGAACTTGACAACAAATCCCGTGAATCGCGTGTCCGTCCATCGTCCATCACGGAAC
CAGAACGTGCGTCCTTCAACGTCCACTTTCCTCGTCCACTCTTTGCGTCGCTGTGCCCGTAGTCGACGTCGAGTCGTTTGGTGCGTCGGCGTAGCCGTGA
CCAACTGCACGCGACTCTCTCGCTTGAACAGCGGCAAGAACGATAGTCTCGGTGCCTTCTTGTCTCCGTTTTGCTGTTCGTCGTCCGCGAGCGCCTGTCC
GCACACGGTGCAGAACTTGACACGTCTGAAGTTCTCGAAGCTGCAGACTGCGCAAACGTTGAATCCCTCCTCCGCGTCTCTCAGTGCCGCGTCCAGTCGT
CGATCGTCAGAGCTGCAGCAATTGCAAAGTTAGTGTAACTGGGGCCTCAACGGAAGAGCAACGACGCACTTGAGCAGCGGCGCGTGCAGCTCCAGCGACC
GCTGGCGACGGATGTAGGCGCGTCTCGCTAACAGCGACAAGCAGCAGAAGAGCAGCGCGATGACTGCCAGCACAGCGAGGAAGCCCACCACGGCCTGCAT
GTCGTCTCCGGATGAATCTGAGTGTGGCGTGCGTCAAGCATCTGCGATCGATTACCGAACTGGTAGATGCAAAAGTGTTTGTCATGGGTATAGTTTAGAT
AGATTATAAGAAATGAATAAAGAGGAGAGGAGAGACTTTTGAGGAGTACTGTTGTGTCCAGGTAGCGGTACAGCAGATGAGTGTTGAGCTGCGGGCACCG
TACACCGAACGCCGACCGTGCTGATCAACAGGATGTTGCTACATGGCAGGAGCTAGGAAGGCACAGGGCAATGTATATCGCACTCACTTACTTAATATCA
CTCTAGTCTGCACCCAATAAACTTCACTAATCGGTTGTAAACCCGTACACCTCGGTCTCCAGCACCGCGTACAGCACAGCCTTCAACTCGTCGCGAACAA
CGTGCAGTGGCAGGTCCAAACGATTGAAACAAGCGTGGCTGTGAATGAACCCGTCACCAATCAGCGACACGGCCTTCAGTGTAAACGGGCACAGACGACC
ATCGTAGCTCGTCAACGCACTGAACCCTCCGAGAGGAACGCGCGATGAACCAGTTGAAAACTGCAGCAGCCGACGACGATACTCATTTGGCATCTCTCGC
ACTAGCTCCCAGAACCACTTGAGTGAGCGGTGGTGGTGAAGGTCTTCCGAATACTTTGTGTTGCGCTCCCAGTCATCTACGTCGATCTCGTCGGAGCCGC
ACAGCAGGAAGTCGAACTCTTCCGGGTCGAATAGCAGGAGAAGTTCGCGAGGGACGATTTCGTACAGGCCCTGCAAGAAGACTTGCAGTTGAGGGGCCAC
ACTTTCCACAAGCAGGTATTGCCACTTGAGCTCCACGAACTCGCGCTTGTTGGAATCGGTGACGGGAATGGCACTGCCGCCAGGCACGAGCTCGATATCG
CGATAGCTATCTCCATCCTTGGTAGTCACGGTGAAATCGAGATCTAGCGCATCGACATTGTCGTTCTCCAGTAACCAACGCAAATTGCTGTACACCTCTG
GGTCCAAGTCCTCCAAATCTTCAAAACTTAACGGGTAACCCAGGATCAGCTTCAAAAACGGCGAGGCCAAGTGGAAGCACAGCATAGAGCCCTCCAGGAG
TGCACGTCCCAAGAGACGACCAGCCGCGAAGAGATTTAGCAGCTGGTTAGGAAGTAGTCCATATCCGAGCAGGGGCTCATGTAGTATGTCTGATCACGCT
TGTTAGCACAAACAAAGAGCCCACGTACTGGATCCACAAGCGCCTCATTGAGCATCACAAACCACTCACGTTGAAGACCCCCAGCGTCCACACCGTTCTC
ATCGAGGAAGTTTATGCGCACTACAGAACGAGCATTCTGGAGCGGGATGATAGCGAGGGACTCCATCGAGTCTTTGAACACGCTGGCACGCTCAACGTTG
AGCCGTAGATGCTCTCTTTCAGCTGGAACCAGTAGGGCTGAAGCAGCCATGACGAAATGTGCATACTTGGAGGGAAAATCTTTACTAGCGAGCGCCATTG
CCAGGGGTGGTGGTGATGCATTGCCTAGGACAGTATCGGTTCCCAATGCTGTACGAATTGGACTGTTCGGCAGAGTGAGAGGAAGTCTTGTGGCATCCAT
ATCAGCGTCAGCTGCTGATGTGAACACAGAGTGCATCTCCTGTGCGTAGTTTACCAAGCTTGCAGCGCACTCCGCAACCGATCTGACCATAGGTCTTGGC
GACATTGCTCGATTTGCCGCATATTCTTTGTTTCCCTCGGTGTGTTCTAGTTCGGGATCTGGTTCTGAGCTACTCCGGCTCGTTGAAGCATGAGCTTCAG
GTGATTTTCCGTCCACGGCAATTCGACTGTTTGCAGGCTTGAACTCAACAACAAAGCCTGTTGCAGGTGTATCAGCCCCAACATTGTGGCTGTCACGAAA
CCAATATGGGCGTCCTTCGACATCAAGTTTGCGTGTCCACTCCTTGCGTCTCTGTGCCCGTACACGGCGGCGAGTGGCTTGCTTCGAGGATATCGAAAGT
GCAGTGGACGAGGTCGTCTGCGTTCCCGTATGTCGCTTGAAAGTCGACAACATTCTCGTCAACCTTCTCCTCTCGCCCTTGTTGCGCGACGGCGAGCGGC
ACGAGAAAGGTGCCTTCTCCACAATCGGCTCGCCACAAAGCGTGCAAAAGCGGACACGCTTGAAGTTCTCAAACGCACAGAAGTCGCACACGATGAACCC
TTCCTCCGCATCTCTTCACACACAATATAGCGTCAGCTCTGCCAGCCTCCCTTTAATTGAACGGAGACAAACCTTAGTGCCGCATCCAGACGTCGATCAT
CGGAGCTGCACCCAACCAAATGGACAGCAGATAGCCGTTAGATACAGCAACCACACGCAGAATACCCGGACGAAAGCAGATAGCCTCTAGCCTCCGTTAT
GGTCAACTGCATGTGCACGTACTCGATGAGTGGCGTATTCAGCTCCACCTCGCGCTCGAACTTCTTGAACGAACGTCGTGCCAGCCACGCGAAGAAGAGT
GCGAAGAGCAGGGCGATCCCACACGCCACACCGATGGTCACGCCCACAGACATCACTCGGTGGCGTCCTTGAGAAGGGCGAGAAGTTGGAGAGTGTCAGT
GACACTGTGTCACGCTGGAACAGGTGCATTGCACACTTCGATCAGATGCCGATCAAAATTGATGAAACACAGAAGTGTTCACCTTACACAGTGAATTAGT
GGGGTACAAATGATTTGTGGTTTTACAGTAGAAGGTATCGAATCAAAGTTTTCAGACCGCGTCAGTTTGCGGTTGTGGCTGTTGTGTACAGTGACAGAAA
TCTCCAAAGCAAAATGCACTGGCGAAAAGGTCCCTTACGTGTAGCCAACGCACTATTTAACCGGTTGAAGCACGCGTGACTGTCGATGTACTTATCGCCC
TCTCAGCGAAAATGCACACAGCCATCTATCGTAGTGCACCGCAGCCACCGAGCGGTATCCACAGGACGAACCCGTTGAAAACTGCAGCAATCGGCGTCAT
ACTCGTTGGGTATTCCACGCGCCAGCTCACAGAGCAGCGACGTGGTGCAACAAGTTCGAGTAGTCGTTCACGTCGAGCCACACAGCGGAAGTCAAATTCT
TCCGGGTCCAAGCAAGTCGCGAGGAATGATTTCGTA