Description :
From Genome Similarity Track
Location :
Scaffold_365:324- 2211
Transcript NameFunction/comments
Albla_Nc14124460unc45 family protein putative

Sequence
1887 bases(100 bases per row)
GATCCTGTGTCCGACGTAAGTCTTAGCTCATGATGCCGCATTTCAAAAGTTCCCTGCGTCTCTGAAACCCTCACGGACAACTCGATATATCCTCCGGCTT
GATCACCTGATTCGGTCTCACGAGTACAAAAACCCACGTAATTCATACGAAAGACAAAGTATTTCTGAAATGTCTTTTTTAGACTTCATCTAACTAGATG
CATCGATCTAGCGTATTGTGCGAAGATGGAGAAGTGCATGATGAAGTGCCCAAATCGCTTTGGACAGTCCCTCTTAGGCTTGCTAATGAGCATACAAACC
GACTCTGTATATGTAGCTCAGAAATCTTTAGTATTCCAAACGTAATATCGATTCACAATTTTGATTTCTGAGTTAGATTGATAGGCTTTTGAGTCTGCTT
CATTACTAATTACTCTGCCGCATAAAACTCGAGGCATAATCATTCTCGATACCGGAATGACTCAGATCGAACTCGATGTTGTTTGTATAATTGCATCGCC
CTTGTCGATTTTATTAGCTCATCATAGACGCTGGATTACAGAGAAATAATTTGATAGACCTTCTTTGCTACGACAAAAGATCGACTGTTTGACTTTCATA
CTCTTTATAGAGCTTAGCTTTTCATCATATGGCTCCGCGGGCCCTGAAGGTTTACTATACCGCTAACTCGAAGTGATGATAGGCGAGTCAAAGCAGTATG
TAAATTCCAGACTGTTTGTTCCAACGGCAAAAATATGGACCTCTAACTACGATTGTTCCTCATACATGCACCCTGTCAGAAGCTAAGGAAAAGTCAAGTC
GTTTTGTCAAGCCGTTATGGACAGCTGGTGCAGCATATGGAAATTTGAGATCTTTTCCATTATCACAAACGGCCAGTCACACCGGCGATGATAATGAGTG
CTGTCTCAAGTCGAGGCATCAAACGTTGCTGATGAACTGTGCTAATGCATGCAAGAAATTGAAGGAGAGTTCTTGGCGATGATATCCAGCAATATTGACT
GTTATCCAATATGTTTCCAAATGACGACAGAATGATCATGATGTGATATCGGAAATGGAACACAGCAATTATCGTATGCAAATTGTATTTCGCGAAAGAA
ACAATATTTCAAGTCATACGCACGACTTCGATTTACCTAGATGGTAATTTACTCAAAAATGTGAAAGGAGGTATTCTTCAAGTAGCATGTGTTTTGTATG
GGAACCAGCAAATACGAATTATATTCGTGGCCATTTTTTCTATTGGAAATGAAGCCGATTGGACTTACCTTCTTCGGAATTTGAGGATTTGAGGGTGACA
ATTCCTTTCTGGTTCATTGCGTTTATACTCCTGGCTCACTCCCAAGGAGTTACAATGTCAGCTCAGAGCTAATGTCTGTTCTTATGGGTATCCAACTGGT
ATGGAAGCACCTTGTACTCATTTGTTACTCTGTCTGCAATACGAGAACTGCCTTGCTGCATACAGCAGTGCTGTTGGAGTAAAATGACTCCCACAAGTCA
CAAAGAATATGCTCATGGAAAGGGATTGCACTCGATCGATTTTGAAGCAGTGCGCAGCTAAATCCCATTTGGGGTATTTCTCGTATAATTTCGGGATATA
TTGTTTCAATATTTTTTGATTTTGGATATTTTGTTCAATTTCCACGAAAATTTGGATATTTTGTATAAAACGTTCAATTGACACCGACTTATCGCCTGTA
ACGACTCCATCAAATTGTATGCAGCACACTTTTGTACGCTTCCAAACATGTTCGAGCTTGCTCCCGGAGAGTTGATGTGCACTTTGTCGACTTGACGATC
CTTTCCATTTCCACGATCAGATCTTTTCCATGCTGCTTCATATCTTCTGTCATTTGTGGATGCAATGAATCGCTTCCTTCCGTTGAT