Description :
From Genome Similarity Track
Location :
Scaffold_289:32395- 33939
Sequence
1544 bases(100 bases per row)
CCGTTACACCTGGTAGCACTTTGTAGTCCGTCCAAAGACCATGACCATGTCTGATGATGAAGGGACGACTTCACGCATGGAAATCTACTCCCATGTAATT
CAAATTAAATGGGATGCCGTCGAACGTTTGAGTTCGACGATAGGGCAAGAAGCCGTCGGCGCAATGCTGTCTGCACTGGTACAGGACGGACAACACGCTC
CATTGCCAAGTTCATCCAGAATGAACTCGACACTGAAGAGGAAAAAGTAACCTTGCTTCACCAAAATATTTCTCAAAAGTTCATGCTGTCGAAACTGCAG
CAGGCAACTGCTACTGGGTCGATACACACGCGTATACCCGAAACACTGAGTAAAGATATTTCTAAAAACAATGTAGCTGAAGAAGACCCCATGTTAAGAT
GGTTTGTGTAGTAGGAAGATGCCACAAGGACTCGTCGCATCATTGATGAGAATGTTCAGGTCGCATGTGCTCAATCGAACTTGTCAGGACGTGCGAAGCC
TTGGGCGTTGGGCCTCATGCTACACGACCTATAGGTAAGATTCCCTCACATTTCAGCTTAGAAAAACGTTTGCACAGCCACGAGCTGACTTTAGGGCTTG
TTCTGGACTCCTGGAACTCAAACAAAGCAAACGTGATGTACACTCATACATTTAGTACATACGTCGCCTTACGAGTCACCTTACAGCAAATCCGCTGAAT
GAACAAACGTTGATTACGTTGTTCATGCAAGGTCTCACAGACGGTCCTGTCGAGACCTACTTTCCCGACTGGAATTTGATACCCTTGAAGAGGCAATCAG
GGTTGCGGAAAGGACTTTTTCAGCGTGGAATAGGCTTACGTTACTTTGAGTTCCTATCATTCCACGATACGACAGGAAAGTGGAAGCCCAGAGCCAATGA
ACTTCTGCTACGCTGAGAGTAAAGGCTCTCTCGTTAAAAATCATAAGAAATTGCAGAGATGCAATAGGTGTCAAAAGAGAGGGCATGTATAATGCAAATG
CAATGAACCGAACGCGGTAACACGTACCGCAGTAAAGAGTAACCGCCATGCGGCCAAGAAGGGTCGACAGCGGGGTTCCGACGCTGTTGCGAAAATGCAA
CAACGTACGGGACAGTCAAAAAATGGTCGGGAACAGTAGGTGCGGAACCCCTACTGATCCAGCAAATTCAAGTTAATTTTCAGGCCCCTTGACGAGAGTT
CTTCCCTACACACAATCATTGTGTGTTACTGCATCTAGTAACGAGGTTCTCTCATTACCTTAAAGCTAGAAGTAGCAAAGAGTATGTCACTACGAGTACT
TGTCGTTTGTGGGGCGTCAAAACTTTGTACAACGCCAGTCCCTTAGCGAAAGTAAGCTTAATCTCATTGAGCGCGAGATCCCTCCAACGAGGATGACGGT
ACGTCTTGCGACAGGAGCATCCGTAACTGTTATGAAACATGTAGTGAGAATTACCTATACACTGAAAGAGGTCTCATACAATTATAAAATCGTCGTACTG
GAATTGGATGACAAGTTTGATGTTATCCTTGGCTTACCTTAGCT