Description :
From Genome Similarity Track
Location :
Scaffold_28:32392- 35100
Transcript NameFunction/comments
Hyaar_Emoy2804324serine protease family S33, putative

Sequence
2708 bases(100 bases per row)
CTTTATATGAAACATATAGTGTAGCTTTAGCGGCTTGCTGTGGCTAGAGAGCACCATCACTGCTAAAAGCCGATGTCATCCTGCTCGCACTCCTGACGTA
ATCTCTTGCGCTGTCTCTACATCTCAAAAGCGCAACGAGAGATCGTGGCTTGTTAAGCATAGGAAGTCCGATGCTGTCGGGTTGAACTGAAGTGTATGCA
CGACCTTTGTGGGGCCTGATGGAGTCAGCGAGGGGTCGCTTGGCGCGTCGGATGTGTCGGTTTTAGTTCGCGGAAGAATTCAAAGATGAATGGTGGAGTC
ATCTGACTCGGTCGCAAGCACGTTCTCTTCTGTCCGTTAAGCACTGACACAGCGCCATGCTATGCCTATCCAGTAGCACCAAGCTTTTCTAAAAGTACGG
ACTCACCTGCACCAACAATGGGCGCTGCCCAATAAATCGCGTTTACAGCAATCGCACGTGACGCTTGCGTGGAGAACGCGGCGCGCTTATCAACAAAGTA
AATCATTTCGTTGCGTGGTGCTTCCTTGCGTTGCACGTACATCAGTCTGTGCCCATATTTAGCACCCAGACGTCGCGTTTGTCCTACAGCTCGACCGAAT
ATACGAGTGTCGCCGGATCTTTTCCAATCGTTAGCGCGTCTTTGGCGTCGTAGCAGCAACAGCTGTGGGATGAGATTCATCAGACGTTGTCATTAAAGCT
TCGAAAGCATCCGTCGTGGTAACATGAATTCACAGGTGTGGTGTCTGAACTACCATGAGCAACTGCTGACTACGTTGCTGAAGTAGCAGCATTTCAAATG
GTGTCATCACTCCGTTGTGTTTTGTCGAACAGAAGCCGTCTCAGTCTTGTGATCTGGCTCGTTTTACTTTCTCATGTTACACCCCCAGCCTGTATTGGCA
TCAGACGCAAACTTTTATGATGCACTCAACGAAGCCGATGACGACAACGTCTGTTCCCAACCTGACATTTGCCAACAGCTACTTACGGTCGCGGCACTAG
TTGATGGAGCTCCCCAACCAGGTGCACACGATTTTGGACGTCCAAACATGCTTTCTCCCATTTCCTTGGCACCGTTTACAGTTGGTGTCACAGCCTCCAG
CTTAGGCTCATCACTAGATTATGTTAAACGAACTGTACAAACTCCGCACCTCTACACTTCTATATATAGCATAATACGGATAAATTTGACTTTAAGCTAA
TTAGCTGCCCGTAAAAGCTTTTGACGGCGTTTGCAGTACGGAATAGCAAAATCCAAAGTACGGATCAGCCTCGCCCACTCGATAGTCACGGCTCATCTCG
CATCTTATCCCGCGTGGGACGGAATGCGGGACGAGCTGTGACTATTACGCAGGATGCGGGATGCGCGAGATTAGAGCTGCGGAACGGAGCCCTAGTTACG
AACACTCGAAACAGCTCACGGAGATAACATCGTAATTATGGGACATTCGCCTCTGCGCTGTCGCATCGGAAACGCGCACGCAAGATAGGTAGATCGCATC
CGCGGTCACCACCTTGTTTCGACTGTCTATATCAGACTCCTTCCTCCGCTTCGCTGCACACGGCAGCAATGCATTGAGAGTGCTTCAAAGATACGCTCGC
ACCAGGTTTCGGTAGGGGGGGTTCATCCTACCTTACATACTACGTCACCTCTCTCAGGTTGCCTGTTACGACAAGTTTCCAAATCCAGTACTATTTTTCG
TAGTCCGTTGTCTTCAGACACCTTGCACTAACCTAAATATGTAAAGACAGCACTTGAAATACATCACCAGATAAGTAGTAATTGCGCGACATGCCTCTCA
AAGCAGAGACAATCGTCACAATCGAACGAAGTGTATATAGTTGCTTCCCATAGTCGGGAAGTATGCGATACGGTGTGTAGGTGGTAGCAACACATTCGTC
CTCATCTTGCTTCGTGTGCCTCCTGCGTGAATCGTAGTCATAGTCATTCGTCATTTCGCCGGTACCCACCACATGTTCAGATGCCGGTTTACCGCGTCGC
CGCACTGTCAGTGGTCTGTATTTCCCTACCAGTTGTTGTCGCTACCGCTAAGATATCTGGCCTGAATGGCTGGTACCAGTGTTCTGATAAAAATTTCCGA
TGAGGGGAGCTCAGCTGGCGTTATTGCTGAGTGTGCAGTGTACAAAGCGCTTTTGTGCTACCCCGGTATCTGTGAGGCACTTCCATCGGTGGACCCGACT
GTCGACATCTTCGTCAAGAGGTATCCAGCAACATCTGGAGACCCGAGTGCAGCATCGAACGTGTGGTTTGTCGCAGGTGCTCCTGCTTATGCGTCAAGCT
TATGTACGCTGTTTTGCACCTGACTTTGCCTGTTTCTCATAGACTGACATCAAGGTCGTCCTTTAATCTCGTTAAGGCAGTGGAAAAGCTCTTGGCCCAA
ATGCATGAGGAACGCGAAGGGAAAGCTAACATTTACACAATGGACCATCGTGGCACGGGCTGCACCACACGTCTGGACTGCGTGTAAGCTCAAGCTACTA
CTTCTGGCTCTCCTTCTGGCGATGCGATTGATCTGTCCAAGGTCGATGCGTGTGCGCAGGATCTCGAATAGAAATATGGAGATCTGTCTTCGTTTTCCAT
GACGATTGCTGCGAATGATATTGCAACGTTCATCGACAAGTTCACGAACGGGAAAAGTACTATTGTCTACGGTATGAGTTACGGAACTGGTCTGGTAGAA
CGGCTCAT