Description :
From Genome Similarity Track
Location :
Scaffold_24:323893- 327834
Sequence
3941 bases(100 bases per row)
TATTCACTGTTAAGATGCAGGTTTCCCCGGAGTCAACATGCAAATATTGACGAAGAAGATGCGATTTATCTAGAGTTGGTATGCCTCGTTGCACGTATAT
GCGCTTATTTACCTCTTTAAATAGATATACCGCATGATCAAATTTTAAGGTAATGTGCGGTCAGTTATTGTTAGAACTAATTCTATATTAATTATAGTCA
TCGCACTTTTACTGGCTACAATTCATAGCGATACCGCTTATATTTATAGCGGCAATGCACTTCAACATTAAATTTATACTCTATGCGCTTGTTTCCCTTG
GGCCATCACTATCCCTCTTGAACCGTGATGCCCAAGAAAAACAAGCGCCTCGCACATATTGGCAAGCTGGCCGACTCAAAGCGTTCAAGTACCAGTCGTA
CTCGTCAGCCAGCCCGCCGGCCAACATTGGCGGAAATAGTAGGGGCTAGCGTCGGTGCGCCAAGTGCCCCTACGAATGCTGTTGTGAGCGACTCAACTTC
GTCAGAGAGTGACTGCTCCGACATTGAAGGGCCAAATGTATACACCCTTCAGTTTATTTATGCAAAAAAACTGATCTGGATTGATAGATCTGCTGCTACT
AGTTACGAGGCGAATTCGGTCGTTAAAACTATACTTCTTAACCCTTGCTTTAGGAGTTATCCGGGCTACAGGGTTATTAGGATTCAAGCGTTGCTAAGTA
ATCTAATATACCTTACCATCATAAAAAACTATACTTCAGCACAGAGGACACCACACCCGCGATTCGTGTCGACCTTTGTGCACTGGCTAGTGTTTCTCCA
GATCTCCAGCGCATTGTTATCTTGCACGCTACAGTGTGCGTGTCTGAACATAACGCATCGCTCTGTCGCTGGCCTGTGCAGACGATTGAGCTTGAAGAAT
GTTCGTGCACGCTCTCTGATCTCGTGGGGTGTTTGAGGGACCCCGAGTTACGAATGGCTCGGGGACTCGTCAAACTCGCGGGTGACCCCGCGTATGAATG
AAGTGTTTGTCGAGGAAGAAGTGCGCGAGTTGCTGCCTCACGATGGCGAATTTCCGCCTCCGGTCAAGGAAAAACTGCCTAGGAGTTCGAAAGCGGCCCA
TGGTCAGTGCGGTCATGACGTGGACCAAGAAAACGATTCATCGCCAAGATGCGTACATTTTGAGCTTAATCTTTTTGTTCGCATCAACACCAGTGCAGCG
ATCGGTTGAATCTGGGATTTTTCAGATCATTATTTATTTTCTTTTATTTGGACCTTCGACGCAACTGTATCTCGCTAAGTCTACTACCCGTTGGTGCTCT
ATCAATCGGATATTCAAAACGAGTGCCGCCTCAAAAGGATTAATTTTGCGTCGAAATGCGCTGTCACTGTTGCCCTTACTCAGGGCTCCAGCGCTCGTCT
TCTTCTAGCTCGACACGAGCAGATTACAGATTGCTGCTCCGGGGTGGACGCGCACACGAAGATAAGCTGAGTATGTCGGCGTCTACACTGTAGACGATGA
ATTGGCTTCAACGCACTGGTCGAGGCCGTGACGACGCTGATCATAGCACATTTTGCCTTACCAGGGACTTCTTTTCTTAGCAACAGGTAGGAACTCGCCG
TCATGAGCCACCAACGCTTTCTGTCCTCTGTGTCATATCGATGCCGTCGTGCTATTACTTCCAGCTTGACGACTTTTCTGGCCATTCGTAGCGTTGGATC
TCTCAAACACCCAGTCCAGTTTTTTTTTTTTTGCGGTGAAGAGATCATCTACTTATGTTAGTTGCTAACTATTCAAGTGGGACAGAGTACCTGGATGTTC
GTGTAACGATAGAGTCATAATAAGGCCATTGACGGAGGGAATTGTCATCAGCCGAGACCACAACGTGTAAATAAGTGATCGAGAGATCCTGAAGCTCAGG
GGACGCAGCAGCCAGCACACAAAGATCGGACATAATTGTTTTGATTGGGATGGCCAAGTCCTTAAAGGTAAACAAATATCTTACGTCTGACCGATCAAGC
GGTTCTAGGGGACGGCCGTTGTACTCAGCTACGCCTTAGGCAAGTATCGTATGCAGGTATAGTACCGTTTACCGGGGTCGTCGGACTCTGCAATATGCAT
AGGCAGGGTCCCCATCGTCAGTACACACCGTTAACGAACGGATCTCGCAGGTGGCTAGCCGCAGCAGATCCATCAACACCTTGGGACTCTCGAACCCTAA
AATACTTTTATTTTCAGCGACGTGCTCAACTGTTTGACTCGGAAGTCAGATTCCCAATAATTTGGACGCCTCCGCCACGTTTCGCCTTGAAAACGCCGCA
CCCGGGAACAACAAAATGCACCCGCGCCTTGTCATCACCGTCACCAAACCCTTTACTTAAGTGTTAGGCGCTTTTACCCCCATAGCCTCTAACCTCCGAG
CTGCTTTTCGAAATAAGGGGGTGTTTGGGAGACCCTGCCCTACGAATGACCAGGGATCTTGTCAGGCTTCAAGTGGATCCGTCACGACCGGGCGATCAAG
AAGTGAGAAAGTTATTGGTGCACAACAGTGAGGACCTACCTCCCATGAGACTTCCAGCCAAGTCAAAGGCTGCCATGATCAGCGTCGGCGCAAGGGTGAG
AAGTACCAAAACGCCGATTTACTGCATGGACGCATAAGTTTTAAGTACCATTTTCGAGTTTGCCTCAACTCCAGCGCAACGATCAGTCGAGTACAAGGAG
GAGTACTACTGGTAGAAGCCACCAATATTTTTTTACTTTTGATTCACGTGTCAATAACGACAAAAGAATGTGAAAGTTATTGTACTTCAAAGTACTTCGA
AGCAGCTGATATTGTGAACAGATCGACGGCTTCTCGCAGCAGCTTCATCGAAAATCCGATATTGAGGTCGAAGCTTTCAAATGCAAACCAAATTGCAACT
TCTAGTATATCGAGCCTAAGTTTCGTCTTGACCAGAGGTAAGCAATCGCGGTCATAAGTCACCAAATTACGCACTTCTCCTTGCAAGGCGAAAGAGTTCC
AGACTAATTTTGTATTCCAGGAATACAAAAACTACTACAGTCTGTAGTAGTTGGGGTTCAAATGGAGTCTATATATTCCGGACTCGAATCCGTCTAACCC
TATACGCAATGGAACGCTGCGTCGGTGTAGAAGCGAATGCAAAGATTAAGCTCAGAATATACGAGTCCATGCCGTAAATTGGCTTCGTGCTCCAAATCGC
GGCCGTGACGACACTGATCACGGCTGACTTCGAACTCCTAGGCAGTTTTTCCTTGACCAGAGGCGGAAATTCGCCGTCGTGAGTCATCAACTCGCGCACT
TCTTCCTCCACAAACACTTCATTCTTACGCGGGGTCACCTTGAGTTGGACGACCTCCCGAGCTATTCGTAACTCGGGGTCCCTCAAACACCCCACAAGAT
CAGCCAGCGTGTTGGAGCATTCGTCTAACTCGATCGTCTTCACAGACCAAAGGCGCAGAGCTGCGTCGTGTTCAGACACCACCACCGTAGCATATCTGAG
ACAGAGATGCAGGAGATTGGGGCAAGCCCTAGCCAGAGTGCAAAGGTCGACATGACTCGCGGCTGTAGTGTCCTCTGCTTTGAAGTATAATTTCAGCGAG
CAAAGGCCCCTCGTGACCAGCACCAACACATCTATCAACACACCCGGGGTCTCGAACTCGACATAGAATAGTTCCAGAGCTCCTTTCAATCGTTTCTCCA
GGCATGCAGGCCTCCCAGCATCAGCAGCGAATCGGACGCCTCTGTCGCCAAGTTTTGCCTTACAAGCACCATATCCCGGGACGACGAGGTTGACCCACTC
ACTGTCGTTTGAATCGAATAGGGCTCGACAGCGACATGCACAGGCCACCAAAACCGAACCACCATCCCCATCAAATGCCCCAGAGAGGCGCAGCTCTGTT
CGTTCATCGATCTCGACAAAACCATACTGATGGGAGCTGTT