Description :
From Genome Similarity Track
Location :
scaffold_83:32389- 35285
Transcript NameFunction/comments
g3062.t1 hypothetical protein PHYSODRAFT_558912

Sequence
2896 bases(100 bases per row)
GCGACGCCTAGGACGGAGCTGGACGCGGCGCTGGACCAGACGCTGATGCTGTTGCGCACGGCTCTCAAAGCTTCGCAGGGCGTGACGCTAGACGACGCGT
TGCAGCAGAAGGCGACGCAGGTGGCGGCTCTGGCCGCGCAGGTGCAGCGCCGATGCGCGGACGCCGCCAGCTCCAAGCGTTTCGAGCCTCTGGAGCCCAG
CCACGACGCTAATGAGAGCTGGGCCAACAATCCGCCGGCGGAAGCGGCGCCGCAGCCCTCGGTCTGGTCCGGATTCTACAACAAAACTCTGCGTGAGCGA
TTCGACGTGCTGGCGCTCATGTACCCGCGTCTCAAGACGCTCAAGACGCAGCAGACAGGTGGAGAGGCGGTTGCGGATATTCTGCCATCCACGGATCCGG
CGGCCAGACTGGGCGAACTGCCGCTGCGCACGGCCAACCTCATGATCGAGAACTGCATCGGCGTTCTGGGTGTCCCGCTCGGTCTCGGCCTCAACTTCGT
CATCGACGGCAAGAGCTTGTCGGTGCCGATGGCTGTCGAGGAGCCTTCGGTGGTAGCGGCGGCCTCCAGCGCCGCCAAACTTGTGGCTGCTGCCGGCGGT
GGCTTCCGCACAGCGACGTCGGGCAACATCATGACGTCGCAGATCCAGCTCGTGGGAACGGAGGACATCCCGGTGGCGATCGCAGCCATTGAATGCAACC
GCGAGCGACTGCTGTCGATTGCCAACACCACACTCTGCCCCAACATGAAGAAACGTGGCGGCGGAGCTGTGGATATTTACTGCCGCGTGGTCAGCCAAGC
TGCTCGATCTACAGCCGTTGCGGCTGCTGGTAGCGCCTGGTACACTTCATGCGCCGATGAACTCGTGGTGAACGCGTCGGACCCGCAGACGCAGTTCCTG
GTCGTCCACATTGACGTGGACGTGTGTGAAGCAATGGGCGCCAACATCGTCAACACCGTAGCGGAGGGGCTGTCAGAAGAAGTGTCCAAGATCACCCGTA
GCCGTGTCGGTCTGCGCATTCTCACCAACCTTTGCATGCAGCGCCGAGCTCGGTCTGTGTTCGAGATCCCTGTGAAGAAGCTCGGCTGGAAGGGAGTGGA
CGGCGAAGACGTGGCCAACCGCATCATTGAGGCCTACAACTTCGCCGCTATCGACCCGTACCGCGCCGTGACTAACAACAAGGGGATTATGAATGGCGTG
GACGCTGTTGCAGTGGCCACCGGACAGGACTGGCGAGCCATCGAATCTGCTGCGCACTGTTACGCCAGTCGTTCAGGGCAATACGCGTCGCTCTCGCACT
ACGAGATCGGCCTTGCCAGTGACGGGTCTGGGACGCGGGTGCTGCGTGGAAGCCTCGAGATGCCTATCGCAGTCGGATCGAAGGGCGGCGCGTTGATGAC
GCACCCTGGTTACACCGCGACCCACGCGATACTACAGCAGCCGACGGCTCGTAACCTGAGCGGCATCATCGTGAGTGTTGGGCTGGCTCAAAACTTTGCT
GCAATCCGCGCAATTGCCGTGACAGGGATTCAAAAGGGCCACATGGCTCTCCATGCACGAAACATTGCCGTTGCTGCTGGTGCGCCTAGCGAACTGGTGT
CGGAAGTTTGCAGCTACATGCTGCTGCGAAAGTCTATCAACGTGGAGACGGCGAAGGAGTACTTGCACGCCCACGCTGTGTTTTCGGAGATCCAGAGCAA
CTCGCCTCCAATCTCCCCAGTCTCGATGACGCTACCTTCCATGTTCTACGTGGAAATTCCCATCCCGGAGCTGGAGGACACAATCAGCCTGAATATTGCC
TTCGAGGCTATCAACAAGCATCCACAGTACATCGCCATCATGGCGCCAAGCGCTGCGAGCAAAAGCGGTCAGACGCTAACGACATTCCAGAGGCAGTTGC
TGGGCGACAAGGGCTACAACCAGCTTGAGAAGATGTTTCGGTTCCTGGCCTCCATGCGCTCCATCGTTATCTCGGCTTCGAGCTCGGAGGGCGATCTGCT
GCTGTCACGCTCCAACATTGGCCTGCAGAACAAGCTCCAGCTGCTGTCGATTCTCATTAACATCATTTCTTACCGGCTCATGGAGGTGCGTCCCCAGAAG
GTCCGCACGTTCATGCGGCAGCTTCTGGAGGCGAGCAGCGGGTCTGCAAATGGATCCAACGACGGAGCGATGCACGAGTTGGACGCCAAGTTTTTTCACG
ATCTGATGGTGGAGAATGTGGAGCCTGGCGATGAACTGCTGGCGACGGGTTTACCGCTGTTCCTCGCTCTGTGGCAAGTGTTACACTACCACATCGAGCA
GGAGGTACCTCACAAGCTGCTCCGTGTTCGTCTCGTGAAGGAGCAATGGGGGCTGCTGAACGACATCGTACGGAGTTACGAGCTCGGTACGCTTTCCGAC
GACACCACTGCGACGTCTGCTCCTGACCAACCGCTTGAGGAGAAGTTCTTGGAGTACGTCGCAGTGCAAGCTACGCGTTGGCAAGCGACACTGCTGCTGC
TCATCGATTCGCTGGTGCTGGCGTCGGAGCTGGTGACGCCTGAGCGGCTTGACTTCCTCGCTCGCATTGGCGAGTACATGGAGTGGGAAGGCTCCATCGC
GCACGATCTGGCGCGCTACCAACGCGATGCTACCGAGCGCGTACCCAACGCCTATCTCTATTGGCTTTCACAACGTGGGATCCCTCATTCGGAGGGCAAG
AAGTACGAGCGTGAATTCCGCGGCGTGGCCGACGCCTTGGCGGCCGATAAATGGGACAAACTACTGCAGGAAGCGCGACGGGACTCGTGGGCTGCTGCCG
CTTTTTCGTTGCCAGCAGTGGAGCGCGTCATCGGTCTCATCCGCGACATCTACGGCGACCACAGCGGCCGCAGCATCCGGAAAGAGTCGTTCTAAG