Description :
From Genome Similarity Track
Location :
Scaffold_53:3238- 6326
Transcript NameFunction/comments
Phyke_g3470hypothetical protein PHYSODRAFT_301780
Phyke_g3471hypothetical protein PHYSODRAFT_315622

Sequence
3088 bases(100 bases per row)
TCAAGGCGGTGGATTTTCAGCCGTCGCTGAAATGGGTACTAGATAGTAAGAGCCGTGGCCACCATGGTGGCCACGGCAGTATTATAGTGTCTGGATGATA
GTAGAATATGTTGCCTGCTCTCATCGCCGTCACACGCCTCATGGATGTAGAGTGTCAAAAAAGTGGGTTATTTATTTCTCCGtatacaaatatcaagttA
ATCTCTGGTTTTTGGTCTTTTTAAGTGTGCATAGTCGGGTCAGATTACGGTGTTATCTCTGGGACGTTCTACTTTCTCTGTCATTGTGCACCCAGACGCA
TCACTTTCAAAAGAGCTCCATAGATCAGACAACGCACAAATAAAGACATGGCCAAGTTCTGCGCAGAGTGTGGGGCCAAAAACAATGGAGGCAAATTCTG
CTCCGAGTGCGGCAAGCGATTCACAGACGACGGAACTACATCCTCAGCCTCATCATCCCCCCCCTCCTCCTTCATTGGatcagcaacaccagcagtacCA
GTCGCAGCGTATCAAGGGGCAGCAACAGCTGTGGCCTCGGCCTTCCGCAGTGAAAGCTCGCCGTATGGAGCCAATTCGTACAATCACGACCCTAGAAGCA
GTTTTTTAAACAATaagcaacagcagacgcctcctcctccaccacctcctccgcCAATGGCGCAGCCCTACGTGAAGAAATCGGTACCCAGCGCATTCCG
AGGGGGCAGTTCAgtgaacaacagcagcagcagcagcagcagtgtgaaTGTCATCCCAGTGGCTTCGGAGCCTGttcctccagctgcaacgGGGGTAGAA
GCACAGCAATTCTATGAGAGATGTGTGAACACCATCCGAGCTTCCAAAGGCGGAAATAACGAGCGAGGAGTGAAGGAATTCAAGCAGAACTGCCGTCGCT
TCGGTCTCAAGGAGATGGACGTGCAGCCCTTCTATGCCTCTTTAGTGGCCGAGTTGGGAGCCGAAGGGACGAGGAGTTTTGTCCCCACACTGGCAAGATT
AGTGCCCGATGATGACCGCAGAAAGGAGCTGATGGAATATAATGCACAGCAGAGAGCGCGTGCCttcagtggcagcagcaatggcagcagcgatggacgG
CAGTCGGCCTTTGCCAGTCGGAACTCGAGTATGGCGGATTCCTTCCGTAGTGACTCGACTGTGGGGACCAATCAAGGGACTCAGAGCAAGGGGATACTGA
ACAACCGCTACGCAGACCACCCGAACTGTGATGTGTGCAATGTGCGCTTTGATGTGACCAAGAGGCGGCACCAATGGTAGGAAAATTGTTGCATTTGTTC
AGTGGAAATTTGTGATTGTACTGACAGAGTTATTGTGATCTTCGCTGTAGTCGTACTTGTGGactcttcatctgcagctcgtgctctCCTGTTCGACTGC
TGGTGCCACCAGGGAAACAGATTGAAGGCGCCAAAAAGTACGACCCGTCCCTCCCACAACGAGTGTGCATCCAGTGTGCCCCGCAGCTTCACCCGCTTCA
GGACGAGTTGGTGGCCACGTACGCGCAGTCTCAAACTGACAACGCCCATGAAGCTCGCGGCCGCCTTCACGTACCCTTTACTAATTCACTGAACAAGGAG
TGCTGCAACGCTGCTGATATCATTGGCAATTTTTTCCGCAATGATTGGGGTGCTTCCGCAGACCGCGCTATCCCGGTGGCATTTTTGCAGAAGGCGCACG
GCCTTGCAGTTATGACAGTGCTGAAGGCTGGTTTCCTCGTCTCTGGCAAAATCGGTACAGGTATAGTTGTTGCCAAGCTGCCTGACGGATCGTGGTCAGC
GCCGTCCGCCATTGGCACGTTCGGACTCAGTGGCGGCTTTGAACTTGGCGGCGAAATTGTGGAAGTTATGATTATCCTCGGCTCAGAGGGCGCAGTAAAG
GTATTCCACAAGCCCCAGGTAAACCTCGGAGCCGGGCTAGATTTAACTGTGGGCCCATACGGACGATcagcacaggcagcagcagctgccaGTACGAGCG
GCTTGAATGCCAACTACAGTTATTCGCAGAGCAAGGGTTTGTTTGCCGGTATCTCGCTGCAAGGAgccattgttgctgcacgCTCAGACCTGAACCGCAA
GTTCTATGGTCGTGACTTGCAGCCGAGCGAGCTGCTAAGTGGCTATGTGGAGCAGCcggcagcagctcgtccgcTGTACGAGGCAATCGACAATGCGATG
CAAGGCATTGAAGATCAcaaggaggagcagcagcgccgatCGTCTGTCTTGGGAGCCTGCCGACTTTGCAATTGCCCCATGTTTCAGGCCCACACGACCC
AGGTATGGAACAAGAAGTGCAAAACGTGCAACCATGCTCACTAAACAACCCATACGAAAGCACTAATAAGCCCCAGCCTGACTGATGGATAACCGATTTC
GATTGCATGTGTGAAGTCAAACAACATTGTGCTGCGTTCAAAATTCGTCTATTATGTACAAGCTCTATATAGCGTGAAAAATTGGCTAGCGTAGCAACCT
CTCTCCAGACTCCCTTATGTCTAGCCGAAATTGTGCTTGCGCTGAGAATGGCCCCTTTGGCAGCTCTAGCCACGTGGCCCAATTCATCTCGAATTGCCGG
TGACGCTTGTCATCATTGCCTTCTAGACGCGTGGGCGGCACCGCCACTCGCAATTTTGCAACTACGAGAGAGCTGCCAGGGACAGCAAAACGATTGACTA
GATCGCCATGTTCAGGGGCATCGGCAATCCCAGACGGCAGTGTCATCACATAATCCATAACAAACACAATTAGGGAATGCAGACGAGAGGTTGCGATGGA
GTCGAGCTCGTCACAGCGGTCTACGATAGAATGCACAATTGCTTCGAGCATTGATGCAAAACGTGCTACAAATTCTGTGAATTGTCGCTCGATAGACTCC
GTGCGTCCATCTTCCATCGTGAGCAGTGTGCACGCAACAAACGTTTCCAGTGATAGACCGTAAAACTTCAGGCAGGACAGCACGGCACGCCAGATCACAT
CCCAGACTACCAACCCTGAAATGCGTAATAGAGAAGCAGCGTCACCCCTTAAATCTCCAGCGGCCACGCACTTGGCAAATGCGCAGGT