Description :
From Genome Similarity Track
Location :
Scaffold_31:323730- 326184
Sequence
2454 bases(100 bases per row)
GCGTTCGAGCCCCCACAAGACGAGCACCACCACCGCTCAGCTTTTCTCACGTTGAAGCCGCGTGTTCAGTCAATGCTGGACTACATCCAACGCACACGAC
ATTTGGCGTCGTACATTAGCGCCGATCCCATTGATACGGTGACACAAGTCCATGTGTTCGTCACAGGAATGAATACTGGACATCAGCATTTCTATTTGAC
ACGGAAGCCTCCGGCGTCCCTGGAATAAGCGTTCAGCATTGCGCTACGCGAAGACTTCAGTGTCATGGCTTCAAAAATGGATCAATCGTTTCCTCCTCGT
GCCGCTCATGCACCTGATCCCATGGAGATCGACGTGATCGAGCACACCACTGGTCAAAGTCATGCTCCCAGTCGTAGCTTTCGAAGGCCTGCGACAGCGC
AGAACCTGGTCTGCTTTCATTGTCGTAAATCTGGTCATCGCGCGACCTTTTTCCACGCGCCTGCTCCAGTGCTCGCTGTCACCGAGTCGGACGTTTCCGT
CAAGGTCGCCAGGCAGCCAAAAAAAACGAAGAGAACCAGTAGACGTGCGACGTCCTACTGGTCAAAGACGGAAGAACGTGCCTAAAGTGGCGACACGCTC
TCTTAGCCCCGCTGTGCATTACGCACAGCTTAATACCACCACATCCAGTAACGATCCGCGGTTGATTGTGCTCATTGTTCACGTTGACATTGCGTCACGT
CCACTTCGCGCGTTTCTGTACTCAGGTGCGTCAAATAACTTTGTTCGCGCCAACAGTCTGTCAATCCTACCCTCGCGGTTGCGTGTCCGCGAGTCTTCTG
GAGATATGATCATTAATTATGCGGACGGCAAGCCTCGCACGCACCGCCAACATTCGGTGGTGTTCTCCTACCGGTTCGGTACTTTTGACAGTAGTGATGA
GTTCCAAGTGATTGACTTGAGTGAACCTTGTGACTGTATTTTTGGGATGCCGTGGCTTGCACGGCATCGATCTGACATTGATTGGCTAAACAGTACGGTT
CAGCCACGTGATATAGATGTTAACGCGGTACTTGCTGTCCTTGACGGCCCTTCAAGTACGTGGCAGCATGTTGCTGTCGTGGATTCCGACTCCACTACTC
AAAATACCCCCGAAGTGAGCGATGGACCTTCGCGTGTGGTGTGCAACTCCGCAACATGCTCCCTCACAATCGAACAGTCGTTCCAGAGTCAAGAGTCTAA
CCCACTGCAGTGGCTCCGGGTGTCGCACGGTCGAGCAGCGGGTCCGTGCGTGCAAAATATTCAAAAATCGTACCGAAGCAAGGACTTCCGGTACTTCACG
AGCGTGCAGTGGCTCCCGTGTCAGTCCAAGTTTTGGACCCCACGCCGAGGCAGGGGCCTCCGGTCAGTTACGCAGAAGCAGTGGATTCGGTAAGTCCAGT
TGGGGACATCACGCCGAGACAGGGATCTCCGGCTAATTCCGCGGAAGCAGTGGCTTCTGTACGTCCGGTTGTGAATCGGATTCGTGTTTCTGTGTCGCAA
CGACGCAGTGGCGCCGCACGCGTCAACAATCCGTTGTGCCGGCGAGTTCTACCACGCCTGCTCCGCCTTTGGAAACTATTCATGTCGTTAACATGACTGA
TGCTGGTCCAAGGAGCCATCCGTTGCAAGTCCCGAGTCCACCTTGCGATGCGTCTGGCATCACGCAGCTCCCATTCTTCCTCTAGGATGAGATGCTGCAT
GCCCTGAAGAGGGGGGAGATCGAAAAACTCTGTGTATTCGTTAAAGCACCGGCACCTTAAAACCATGAGCGCCCAGAAGGTATGGAACCGAAGCCCGCTC
GCGAGGAGCGCATCGAAGCTCAATCATGGGAAGAACGGGTCGCGTCGAAGAACCCTGTTCTCGCTCTCACTCTTGAGCTCTCTGATGTCTTCCCTGACAC
AATTCCAGCGGTTCTTTCAGCTTACAGAGACGTGCTACACGAGATAGATCTCGTTTCTGGATCCAAGTATTGCGTGACACGTCAGTGGTCGTTACCACGT
GACCAAGCTGAAGCGATTAAAGCCTTATTTGAAGGGCGCCGTCTAGCCGGCCATGTGCGCGAGAGCACGTCGCCACACTTGAGTCCCACCTTCTGTGTCA
AAAAGGCGACGGTTCAATGGTGTATCGTTCAGGTTTTTAACAAACTGAACGATACAACGATTTCAGCGCGAACACTGATTGCACGGAAAGACATAGTATT
AGATACCATGTCAGGGAGCACGATTTTCTCGTCCTTGAATCTGACGGACGGCTTCTACCAAATCCTGATGCGTCCTGAGGATGTTCCGCTTACTGCCGTC
AGTATACCTAGCAGCATGTTGTGGAAGTCGATTGTGATGCCGCAGGGGCTCAAAAATGCTCCTGCTACGTTTAACCGCACTATGTCACACATACTTTGCC
CATATCGCGATTTCGCGCCGAGCTACTTTGACAATATTTTCGTCCACAGTCGCG