Description :
From Genome Similarity Track
Location :
Scaffold_36:323726- 325162
Transcript NameFunction/comments
g3890.t1hypothetical protein

Sequence
1436 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAATGGATATATTCAGGTTGACCACTCCACAGGGTGGTCCACATTCATTGCAAAAGGCATATGACTGGTAGAA
AGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAAACTCTCATTAGAAATATCAGTTTTAGGAGGAA
ACCCCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTTTCGTTCGGTTCCTTTATCTAGGTTTAAGTATACTTGCGGATACAAGTATACTGAAC
TTAAGTAAATTACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACATTCATCGTGAAGGAACAG
TGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGAGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAAC
CTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGG
ACGAGCAAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCC
CCGCAGAACGAGTTCCGATCGAGGGTGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGA
ACATCGTGACCAACCCGATCGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGTCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCC
AAATACTCTCGAGGCTGCAATTGCGCTCGCAATACAAGAAGAGTTTAGCGTGCGGCAGGCTAAACTGCATGTGAACGTCCCGCGGCTGATGCCACGACCG
GTGGTACGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACGGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTTC
GCTGCGGAAACATCGGTCACTACGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGTGATACTGGGTATCGTCACGGGCAATCAAA
AAACTAGAGGGACCAGCAGGTGCGGGGCGCCCTGCTGGTGATGCGGTCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCGCCCAGTGAGA
GTCAATATCACTGCAAGAAACAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGG
TGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTTC