Description :
From Genome Similarity Track
Location :
contig_50:32372- 34598
Sequence
2226 bases(100 bases per row)
AGACACTTCATGGCATTTCACCGTCGTTGTCCGTACTTGAATCCTGGTAGACAGATGGAGATGAACTTTTAGGATCGACCAGTAGCAAACAACGGAAATT
GTCCCTGATCACTCGTTCACCCCATCCGCGATACCGTGCGCGCCAAATCGATAGGACCCCGAATTTCGGAGCAGATCGTTGCCGATAACTCGGCTTCTAC
TGCGAATTAGAGACTGCTATTTAGATATGTTGCTGCTTTCATGCATACCAAGAGCAGGCTTGCGCTAGCAACTGCGAATTCGACACCCTTGGCAGGGCTG
GTATACAGATTGCAGGTTTTGACAAGAGCGACAAAATATAGTACCATATCCTTTTCTGGCGAAACCTACACGTTTTATGCGACTTCATACAAACTTCTAT
ATTAAAAGAATGAATGTCACTACTGGTCAGATGAATGGAGGAAACTTGTTGTTGAGCAGCTCACTGCTGCTTTAATCGTGGTTGCCAGCCTCTCATTTTT
CAATGGGCCGTGGTAAAGCCCTCACCAACCAAGAGTATTGGTGGATCATCGGGCTCCACGACGGCGGGGTCTCGCTACACGACATCTCAAGAAAAAACCG
GCCGCTCTCGCACCTGTGTGCGGAGGGCTATCAAGACCGAGCGAGGACCGCAGACCTACAGCGGCTGCGACAAGCCAAGGGCAGGGCGTCGGTTAGCACT
AACTGAGAGGGAAGTGCGTGTGCTGGTTCGCACGGCGGCGTCCGGAGAACACTTCGCAGCGGAGCTCAAGACCAAGCTCGCGATCAAGGCCTCCGTGCCA
ACGATACAGAGGATGCTTCAGCGTGTGGACCATCTTGTGGCGAGGTCGATGAAACCTTTACCGCCCAGGGGGGTTCGTATAGCGCGCTCCAGGAATTCCT
CCTCCAGGAATTGAAGGGGGAAGACTTGTAGGAGTCAACAAGTATCCAAGATTCCACCGCGAAGCGAAACCTTGGGTTCTTGGTGGCGTGGGTACCTTGC
GGAATCCCTGTCGGCTCGTTTGTCTTTGACGAAACGGCACTTCACCGAGCTTGTGGCCTTGAAGTTGTGCCGAGCGTACGTCCACTTCAGGATGCACTCT
CAACGACAGAATGGCAGAGTGTAGTCTGGATTTCACACCCAGATTATCGGAAATTCAGGATGCACCTTTACCCAGGATGCACCCCAAACACCAATAGCCA
ACAAATACAGAGTTATATACAATACAAATAGCCGTCACTTATTCTTTTCGACCCTTGGACGGTGGGTCACTCGCTAGGCTCACTCGAGTCTTACAATTCA
GACACCTAGTCAGTCTGAACACTCGTATAAACGCGCACCACTCTCAATTAAGAGAGAAACTATCAAATACTATAGTCAATCGATACACACAGCAGTTAAA
CTATCACTTCGGGGGACAACTGCTAGTCAGTCACCTCGAATAGCAAGGGAATATGAAATGGGCAAACACCAGCACGCTAGCGACCCAACTAGGATATGAA
ATAGGTGGGTCAACCCAGGGTGCCGGAGCGCCTTTGGTCACCACCTAACTGGACTTGATGATATGAGGTGGAGATGCTACAGACGACCCGTCCTTAATGG
TCGCAGTGCCCCTTTTTGTATCGCGGTCGTAGTCTCGGGTCCTCCGGATTTCCGTCGGCAGGCTTGGCCGAATTCACTTGCGCAGTACGGGGTAAAACAA
ACTCTGTTGTTGGCTGTAAGCCTTAAACTATCAACTCTTTCTAGATCTCGGCTCTGGGTGATTTATCTTGATTTCACTATGTCTTGGGTCAAATTGTCTT
CGCTTCAGTATGGTCTGGGTACATTGTCTTCGTAGCTTCAAAAGTGTCGACTCGACAGTTCTGTTGGGTTCTTTGGCGGTAGTTCAATGGCGTTTCACTT
GATGACGTACCACTGTCTTCGAAGTCAAATAGTCAGTGGTCAACCGTCAAGATTCTGGTATTCTGGAGTCAGGATTTTGGAGTCAGGATTCAGGATTCAG
GATGTACTTGACATCCAGACTCTTTGGGCTTCCAGCGCACGACTTGGGTGTTGGTAGTGGATGATCTTGGTTCAGTATCTTTAGTAGTCGTCGCTCTGAA
CCACAGCAAGATGAGGTACAATCTGAGATACGTTCTCAACTGCACTTTCCGCCAGGCTTTAGGCACTCATCGTAAGGGAAAGTCCGGGGGCTGGACATAA
TGCGGGTTTGCAATCGTGGATTTGTA