Description :
From Genome Similarity Track
Location :
Scaffold_259:32358- 35912
Transcript NameFunction/comments
Phymu_g7667hypothetical protein
Phymu_g7668hypothetical protein PHYSODRAFT_327098
Phymu_g7669hypothetical protein PHYSODRAFT_481082

Sequence
3554 bases(100 bases per row)
CGATCTGTCGGCGCGTGTGggcgcttctgcagctccacgccaGACAGTGTCGCCAATACGAGTGCAAGGTACCGCGCTGCCACGACCTGCGCGAGCACGT
CcgcaagttgcagctgcagcagcagctcatggacgacCGTCGTCGTGCCGCCGTGACCCAGCAGTACCGTCAGATGCAGAGCGAGCgccagcaggagcag
cagaaccaaGCTCAAGGCGACGACCCCATGCCTCAGGCATGACCGACAGCACTAGATCGAGCGGTGAGGACCAAAATGGTGAGTGTAGCATAGGATAGGG
CAAACCATATTAGTTGTAGATGTGTGTCAACGTGGCTGAAGTCTCTGCAAAAACAAATGAAAGACGTGGATCAAGCCCGCGCATACTATTAACTGCTCAA
GAGGGGGAGTCTTTCTAATGTGAGATACAGACAGCGGCAGGTCGATCGCGGCTCCTTCTCTCTATGCCTTCTTGGCTCCGAGTCGTTTCTGACGCCGACG
GTGGTGCGAGCACGGACGCTTGCCGTGGTTGGCCTGTAACCAAGAAACAAAAATGAGTATTTCCTCTCTCCAGTGAATTTGTGTCTATCTCGACCTTCTT
CGGACGACGAGCGTTGcggttcagcagctccatggcaATAGGCGTCTCGAACAAGTTGGTCGACGGTACGCTACGCACGTTGGCGACTGCCAGGGCGGAC
GGACGTGCTGCAAGGAGGAATGACACACAGCGATTCAGGCAGTGAGAATAACAGACAGCGTAAAGATAAGAGACGTTCGAAGGCCAAGACCCACCGGCAA
TGGAGGGCAGCAGCGAGGCTGGCGCCAACGCGCTCTTGGTCACGGCGGAGAGCAAGCGCGAGCACAGCATGTCTGGCTGGGAGATTTATGCTGGTTGGCT
TTGTTTGGTAAGGAAAAGCAGAGGCTGGAAGACGGGTAGGCTAAAGTTGCGTGAAAGAAAAGTTGCGCGTATGTTGTGCAACAGTGAATAAATTACGGTG
ATTTACgtaagttgaagtgttgCGCATTATGGAGCCTGCAGTCGCGCGCAGGGAGACGTACCAGCGGAAAGAGGGCACTACGCCGCACCAACGGGCCAAG
GAAGGGCGTCCTGATGGCAATGCTACTACTCCTGGAGAGTTTGTGCGGCTGGCGGCGGCTATCGACGGCTGTGCAGCTTTTAATCCGAAGCAATGGCGGC
ATGTGCTAGACAAGTCGGCGACTGTGCTGCGTCACAGCCAAAGCAATGGCTCTCgatcctccagctgcttAACTATAGgtgacaagaagaagatggagat
aGACGGCAAGAGAACAGCAGCGCTACGCCCTTTGtcaagagaagaagacactTTCGCTCCAGTGGAGAGGGACGGGCTTTTCCCTCTTGTCTCGGTGACG
CAGTATTTGAACCAGCCAGATATGGTAAAGGATATTTTAatgcaagcagcagccgaggagcagcgacagcaggaAATTGAGGTAGCAACAGAGAGGGATG
AGAACGTTGTGgagccagagctgcagattgAAGAAAACGATGATGATTTCTATGACGTGGAGGTGGAACAAGACGACCATGAGCTGATTCAGGCTAAGCC
TATTGCACAGACAGAAGCTTCGCATATGAAGCTGCCTTTGCTGACGACCATGTCGCCTCTGATGAGACGTGAACTGGCACATCTCCCGCCTCCAAGTGAT
GCAGAGATGCGTGAGGTTGAGAACTTTGCGCGTTTAGTGGATCATCCAGAGTTTTCCGAAGACTTTTATCGCGTGCTGAAGAGGTCGAGAGCGCGGAATG
CTTGTCAGCctgcagtagcagcactTTTGACTGGCAAACTAAACAGGCAGACACCGCCTAAAGATGCTTCTCCCAAGGGATCACTACGAAGAAATAAGAG
ACCACGCGGTGCTATCAAACCACTAAATGCAAGGGCGGAACATGAGGAGCTCGCGTCTAAGTTGTCTTCGATGtcagtggaggagaaggatcCCGTTTCC
GGTGTGAATACACagatgaaaatgaagagAGAACCTTTCTTGGCTAAAACAGTTTTGAAGACTTCAAACCAAGGCTTACCTTCAAACAAGCGTAAAATAC
GGAACCGCTCTGTCAGCTACAGCAGATTAATTCAGGAACGACACAAGGTTGAGCTGCAACGTGGGGCTGCAGAATTCCAAGTCCAAGAAACGCTTGACGA
AATCAAACAATTTATCCCGCTTGAAGTAATTTACGCATGTGGATTGGGAAAGTTTGCTTCCCCGGCGCAACAGCGAGCAGCTGAATTATTATTTCGCGTC
GGTGTCCGTTTAAAGAACCAATTGCTTTTCATGGGGATGCACTACTGGAGAGAGTTTACTATAGACGCACGAGAACAAGAGTGGGGGCAAGCTTGCATTA
CTTTGCAGTGCTGGTGGCGTCAGGCACGTGCGAAGCGCGAGCTTtcaaggcggagaaggaTACGGAGAGAGTTACAACGCAGACAAGAAGCCTTTTTAGC
CCTTCTTGCGAGTAAACAACAACAATCGGCCTGCAAGATAACCCGCAGCATCAGATCTTATGCCCTCCGTCGTTCTTTCGAGCGGGCAGCTCTGCGAAGA
AAAGCTGCCGTTTGTATTCAAAACTTTTGGAGACAACTATGTACTCAATGGTTAGCGGTGCGACGAGAGATACAAAGAGAGCGCCGAAACAAAGCCGCCA
TCTGCATTCAGAAGCATGCGCGACGAATCGTGGCCCAGCGAAGACGCATTGTGCTCAGTAAAATTGACCATATAGAAAGATGCCGACGTCAAAAGGCCTC
TGAGATTGCTGCACGAGCAAAGAGAATGCAGATGCATGGGGCTGCAATTTCTATACAGCGCGTTTTCCACAATTGGCAGGAGAGAAGAATTTTGAtactt
cgtcgtcgtcgggcAGCTTTTGAACGTGATAAAAAGAAGATTCTTAAAGTACAAGCACACTACAGAGGACAACAAGCGCGCAGATGGGTGAACAAGCACA
AACACGCCGTTCTAAGAGCTGTTCTTGTTATCCAGTGTTCGTGGCGGTGCTATCTTTCAAGGTATGAGCTGTGGAGACATAGACAGCAAGTCATTGCTCG
ACGTGACCAAGTTCTAAGAGAAATCGACGAAAGCCGTCGCAGCAGAAAGGCAAATGCTCTAGTTCCAATCCAGCTACAGAAGAAGTGGGGCCAAATTTCA
CTGCTCAAGCCCAAACTAGGTGATGTATCGAACTCTCGAGAGGTCCAGGCTGCTAGGAAGTTACAGGCGATGTGGAGAGGCAAGCAAACCCGCAAACGGC
TTCGGTACGAAAAAGCAAAAGAGATGGAGAGATTACGGCGTCAAGTCAATCGAAAGCGAAGACTCGCAGCGGTTTGTATCCAAAGACGTGTTCGAGGGAT
CAGAGGCCGCGCGTTCGCTTGGCGAATGATGGAAGAGTCGAGTGCAGCTCGGCTTCAAAGAGTATGGCGAGGGTACAAAACTCGAATCCAACTTATACAA
ATGCGGTATGCCATCAAGATGATCAATCGAATTCAAGCACATTGGAAAACACGG