Description :
From Genome Similarity Track
Location :
contig_50:32355- 34581
Transcript NameFunction/comments
g9891.t1hypothetical protein

Sequence
2226 bases(100 bases per row)
GCATTTCACCGTCGTTGTCCGTACTTGAATCCTGGTAGACAGATGGAGATGAACTTTTAGGATCGACCAGTAGCAAACAACGGAAATTGTCCCTGATCAC
TCGTTCACCCCATCCGCGATACCGTGCGCGCCAAATCGATAGGACCCCGAATTTCGGAGCAGATCGTTGCCGATAACTCGGCTTCTACTGCGAATTAGAG
ACTGCTATTTAGATATGTTGCTGCTTTCATGCATACCAAGAGCAGGCTTGCGCTAGCAACTGCGAATTCGACACCCTTGGCAGGGCTGGTATACAGATTG
CAGGTTTTGACAAGAGCGACAAAATATAGTACCATATCCTTTTCTGGCGAAACCTACACGTTTTATGCGACTTCATACAAACTTCTATATTAAAAGAATG
AATGTCACTACTGGTCAGATGAATGGAGGAAACTTGTTGTTGAGCAGCTCACTGCTGCTTTAATCGTGGTTGCCAGCCTCTCATTTTTCAATGGGCCGTG
GTAAAGCCCTCACCAACCAAGAGTATTGGTGGATCATCGGGCTCCACGACGGCGGGGTCTCGCTACACGACATCTCAAGAAAAACCGGCCGCTCTCGCAC
CTGTGTGCGGAGGGCTATCAAGACCGAGCGAGGACCGCAGACCTACAGCGGCTGCGACAAGCCAAGGGCAGGGCGTCGGTTAGCACTAACTGAGAGGGAA
GTGCGTGTGCTGGTTCGCACGGCGGCGTCCGGAGAACACTTCGCAGCGGAGCTCAAGACCAAGCTCGCGATCAAGGCCTCCGTGCCAACGATACAGAGGA
TGCTTCAGCGTGTGGACCATCTTGTGGCGAGGTCGATGAAACCTTTACCGCCCAGGGGGGTTCGTATAGCGCGCTCCAGGAATTCCTCCTCCAGGAATTG
AAGGGGGAAGACTTGTAGGAGTCAACAAGTATCCAAGATTCCACCGCGAAGCGAAACCTTGGGTTCTTGGTGGCGTGGGTACCTTGCGGAATCCCTGTCG
GCTCGTTTGTCTTTGACGAAATGGCACTTCACCGAGCTTGTGGCCTTGAAGTTGTGCCGAGCGTACGTCCACTTCAGGATGCACTCTCAACGACAGAATG
GCAGAGTGTAGTCTGGATTTCACACCCAGAGTATCGGAAATTCAGGATGCACCTTTACCCAGGATGCACCCCAAACACCAATAGCCAACAAATACAGAGT
TATATACAATACAAATAGCCGTCACTTATTCTTTTCGACCCTTGGACGGTGGGTCACTCGCTAGGCTCACTCGAGTCTTACAATTCAGACACCTAGTCAG
TCTGAACACTCGTATAAACGCGCACCACTCTCAATTAGAGAGAAACTATCAAATACTATAGTCAGTCGATACACACAGCAAAACTATCACTTCGGGGACA
ACTGCTAGTCAGTCACCTCGAATAGCAAGGGAATATGAAATGGGCAAACACCAGCACGCTAGCGACCCAACTAGGATATGAAATAGGTGGGTCAACCCAG
GGTGCCGGAGCGCCTTTGGTCACCACCTAACTGGACTTGATGATATGAGGTGGAGATGCTACAGACGACCCGTCCTTAATGGTCGCAGTGCCCCTTTTTG
TATCGCGGTCGTAGTCTCGGGTCCTCCGGATTTCCGTCGGCAGGCTTGGCCGAATTCACTTGCGCAGTACGGGTAAAAACAAACTCTGTTGTTGGCTGTA
AGCCTTAAACTATCAATTCTTTCTAGATCTCGGCTCTGGGTGATTTATCTTGATTTCACTATGTCTTGGGTCAAATTGTCTTCGCTTCAGTATGGTCTGG
GTACATTGTCTTCGTAGCTTCAAAAGTGTCGACTCGACAGTTCTGTTGGGTTCTTTGGCGGTAGTTCAATGGCGTTTCACTTGATGACGTACCACTGTCT
TCGAAGTCAAATAGTCAGTGGTCAACCATCAAGATTCTGGTATTCTGGAGTCAGGATTTTGGAGTCAGGATTCAGGATTCAGGATGTACTTGACATCCAG
ACTCTTTGGGCTTCCAGCGCACGACTTGGGTGTTGGTAGTGGATGATCTTGGTTCAGTATCTTTAGTAGTCGCTCTGAACCACAGCAAGATGAGGTACAA
TCTGAGATACGTTCTCAACTGCACTTTCCGCCAGGCTTTAGGCACTCATCGTAAGGGAAAGTCCGGGGGCTGGACATAATGCGGGTTTGCAATCGTGGAT
TTGTACACATCCAGGATACACACTTC