Description :
From Genome Similarity Track
Location :
Scaffold_176:32351- 36379
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_176-abinit-gene-0.22Titin
Pytul_var.sporangiiferummaker-pug3_contig_176-snap-gene-0.14Fibronectin type-III domain-containing protein 3a

Sequence
4028 bases(100 bases per row)
AGTTCGCCAGGATCCTCGACGTCTACGAATGGTGCTCCTATACCGGCTACGAGGGTTGGTCCCGTCGTCGTGAACTTTGCATACTCGCTGAGTTGACTGG
ACCCCTAAAGAAACATAGAGACAGGGTCACAACAACAAATTAAACGCTGCTTGGGGTAGTTCGAATGAGATCGATAGAAAAACACACTTACGTATTGGCT
TTGGATCGACACTTTGACAAAGTACACCGAGTCTGAGAGCAGATTGTACATTGACACGTTTCCGATGAACCTCGTGCTCTGATCCGGTTTGCTTTCAATC
GCACGCGTCAGAAATTCGTGGTATTCGACATCCCAACCTGAGAGTCGTGCGACATAGACTGTAAAAGATACCAATGGCCAGCCGCCACAATCGACTGGGG
CTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCTCCACCTGTAGCACGAATTAGAGCTGGTGCTGGCGGTTGTTGAGGCGATGTTGGATACGAT
GTCACGCCACTGATAGTAGATGGGATGCCAACCATTTCTACGCTGTTAACAGCTGAAATCGTAAACTCGTACGTGATCCTGGCATGAAGATCCCCGATCG
ACGCACTCAGAGTGGATCCGTTCACGTTCATCGTGTACGTGACGTCCAACTCCAGGTTGGATGCAAAGACTTTGTACACAACAATATCAAGCCCACCTGC
ATCGATCGGCTCCTTCCATGTGAGACGAGCGCATCCGCCAGTGATCTCAGAAACTTGGAAGTCAGTGACTGGACCTGGTGGATTTGCTGCTGCTGTCGAC
GCATTCAATGTCTCCGAAAAAGCACCACGCCCCCGTTGGTTGATCGCAGCACATCTTGCTTTGTACGTGGTGTCATTTGCCAAATGCGAAATAGCTAGCA
TGCTTGAGCCAGAAGTCAGAGCATACTGGAGAAGCCCACTTGGATGTTCTAGCTCGACTTCGTATTGGAGAATGTACGCGTTCGGACCGCCGAGAAACGT
CGGCTCACTTAATACAAACTGAATCATCCCGCCTGTGACTGAATTCACAAACATCGTTGGATACCCCGAAAGACTCACGTCCCCTATGTCGACTACGTCG
AGCGTCATGGTGGCCGAGTCCAATTGTGCACCGCCAGTTGCATTCGATAGACTCAAGTCGAAACTTCGACTCGCATACTCGTCGCTGTATTTAATCGGGA
TGGAAAGCATTGCAGATGTTTCTCCATCTTCAAAGCGGACAATGCTGTCGACCTTATCGTTCACGATAGCAGAAGATACTGTGGACGTGACTCGGACAGT
GACGACTCCACTTGTTCCTGTGTAACGGGTGAGATAGACGATAGCCTGGCCCACATTTTCATACCCTCTCCAAGAGGAATCCTGAAACGTAATGCGTCCA
GCATCTCGAGTATCAAGCACGGTGACAACAGTCCGCTGTGCCATCGCACCAATTGTACTGGACGTTGCAGATGTCAGCGCGAGTGTAATATTTCCAAGTG
CAGCCTCGTAGACGTCATCATTTGGAATTGCTAGGTCAATAGTCTTCACATATTCGCCAATGCCGAAGAATACAACGCCTGTTCATATCATAAACGAGTA
ATGAACGTCAAGGAAACCACAACGATAGAATGGCTTAACGAACGCAGTACCTGAATTTGGTCCATCCGATGAGCTATCACACGATGCACCGAAAGACTGT
TGCGTGCATGCCCAGCCATCGTGTGCGAATTCGATCGTGTCGGCAATCTCGAACGTCACGCTTTCTTCAAATGTTGTCCCGTACGATCGCGCAACGTCCA
CGGATACATACTCGCCTTCCTGGGTCGCGTAAGTGATTTTCCTGAACCCAATTGTGCCCAGCGCGCCGCTGTCGATCGTATACGTACTTGTTGACCACTC
GCTTGCACCACCATCCGCGACAGCTCGTACTGCAACTAAGAACGTGTTGTCGCTCTCGATCGCATCCACTTCTCCTATGACAACGGTCTCAGGGCATGCG
AAGGACGATTCGCTATACCTACAAGTAAGTGTGTCTTGGAATGCAATCTCTGACGTGGCAACTCTCGTAGCGGTCATTTCAATCGACAGTAGCGACGAAT
TAATCACTACAGGTAAGTTGATACCAACTTCAAGTTTCGTTGTGGACGCATACAGAAGTGTGGTTGACGGAGTAGTCGGAATCCCACTTGGAGTCAAGAA
GCTTAAACTTGTCCACGTGCTCTGCCCGATTGTTGTTTGCGTGCATACTCGTATGGAGTACTCCCTGGTCGGCAATAGTGAGACTAGTTCCAGGTCACAG
CAAGGAAAGGTCCCGTTTTGCACGATGACGCCATCACTTACAGTGCGTAGCTCAAAAAGGTACGACAAGCTACGCGGTCCGCCAGTATCGCATGGTGGCG
TGATGCTGAATTGAGCTGACAGCACACGCGTTTGCAAAAGCGTGAGCTGAGCTGGATCAGGAGGCGTACTGTTGGTAGTCTGGAACGTTTGCGTCGTGCT
GCTCACGTAACCGATCGCATTTTCAATCTCCAATCTGTAAGTGTATGCTCGCTGGGAAAGGAGCATGCCGCAGTGGGTATAGCTGGTATCTTCATTGACA
GTCTCAAAGAGCACTGCTCCATCCACGAACAGTGATCTTCGTACAATCGCTACACCGCCAGTGTCCTGTGAATCCCACGTAGCACATACATAGACCATAT
TTATATGAAGAAAACGCTCCATTGCAAGCATTGTACATACTCGTACCTTTGGAATCGACCACTTTAGCGAAATGGATCCGCCAGTTGCGGCTGCGAGGGA
AAGTGTCGCGGCTTGCGTAGCGGAGCCAGCACTGACAAATAAGATAAATTTAAAAAGAAAAAGTGAGCAAAAACCGTAATATGCACATTGGCGTGACCGA
TGCATAGAATACCTGGTGTCGACAGAGATTTCATCCGAGAAGCTTCCATTTCCAAACGGACTGCCGGCAGCCATAGATACCACATACCGCGTCGAATGTG
TTAGCCCATCCAACAAGCACGATAGCGTTGACGGTGAGAGAAAAGGAGGGCACAGCTTAGTACGTTCTGTGAGAATCCCACAGATTTGGCCATCGCTGTC
AAAGCAACAAGATCCACTACGAGAGCCTGATGAGCACGTTCGTTCTGCGCAACTTCCCACTGGGTCAATAAAATACGTCGGCGACCACACATGGCCGAGT
GTTTTGGTGCAAGTTGTGCAGCCTGTGATGCTGCTGTAGCAAGTTGCCAGGAATCGCAATCTCGCAAAGTACTGAATCGACTGGGAGGCGCAGCCACCCG
TGTCAAGCACTTGCGAGTGGGACAAATTTACTGATCCACCTGCAACAGCAAGCACGCGTACGTCCGGCACGACAGATGGCGCAGTCGGTGAGGATGTAGT
CACCCGAATAACGTTGTCATCACCGTTGCTGGACGCATTAAATTGATTCATCACCACCACTGAAAAGACATACCCCGAGCTGGCGAGTAAACCCGAGAGC
GTGAGTGTCGTTTGCGCTGGATTGGTCGAACCATTATAGATGAGCTTGTTTTCAGCAATATTTTCGTTTTGATTGCGCTGATACACGATGTAACCTTTTA
AAATACATGTAAAACCAATTGAGCTTAATCTCGACTCCAATTGCTCACAATATTGAAAGCAAGTCATACCTGCTATTGTGCCTCCACCAGTATCCTCTGG
TGGGCTCCATACCAGGGCTACAGAGCTTGATCTGATATCTGCCGTTCTCAACTCAGCCAGCTTTGATGGAGATCGCGGTGCACCAGTCGTGAACCATAAC
AGCTCCCCGTATCCAGTAGTCCCGATGTCACACGAGATGGATACCGTCGCCGAATAATTGGAAAATGGCATCAAGCTACCGATCGTCAGCGTGGTCAAAG
GCACATCGACAACAACGGTACGCGATGATCCATCCGTACTGGCAATTCGAACGCTGTAACTACTCACGACAGCGCCATTGAAGTCGTCAGGAGGTACAAC
TGCGAGCGATACAGAGCATCCGTCAATG