Description :
From Genome Similarity Track
Location :
Scaffold_14:323459- 326624
Transcript NameFunction/comments
Hyaar_Emoy2802639cholinephosphate cytidylyltransferase B putative
Hyaar_Emoy2802640hypothetical protein

Sequence
3165 bases(100 bases per row)
GTCTTGCCATGTTCCGTGCTAATGATGCAAGTTGCTATACAAACTCAAATGCACAAAGCCCTGTGCAAGCCTACCACAATCGTGCGTACCAGTCTTGCTG
TATATCTCCAAAGACCTCCAGTGTAGCGAGAGGAGCGAATCCAGCGACACCCGCACGGTGCAGTTTAGCACAACCCTTCACGCGCCATCTCCGACATGCG
CTCGGACAAGCGCTCCTTGATGATCTTTCGACGCTTGCGGAATGATGTACGCTATGTAGGACACACAACGTCAAAACGAGACACAGCACACTAATCGTCA
GACCGACAACGACGGAATCGATCAAAACAAACACAGCTTCGGTACTTACCAGGCGACCTTCTTTGCTGAAAAGCTCGAGAAAGCCGTGCTGCATGTCGTC
GGCTTTGCTGATCCACTTGTGCACGAACCCGTCGACGTCGTTGCGAACCTTGTCGACCGCCATATCAAATTTGATACTCTTCTCCTTGATGAATGGCACG
TTCATGTCTTTGCCAGAGTACCCGCGCTGTAAGTTGCGACGGATGAATGTGTCGTACTCTGCGATGATCCGGATGATCAAGTCCGACGTCGATATCCCGT
TCGTCCGTCTAGTTTCCAAGAACTTGCCCATGGCTTTAATGCGCGCATACACATCACCTTCTGATGCTTCACCCGACGTATCCGAGTACGGCAGTGCATC
GTGACACACGTAATCAATCTGGTGCTTCTCGATAAATTCATCCGAGAGCACCCAAGGAGCGTCTTCGACCACTTCGTCCACCCATCTGCAGTGCCGCAAG
GACTCGTAGCGTTCCTTGTCCGTCATGACCGTGCGACCCTTGAGTTTGTGCGTGATCTCATCACTGCAACAGCCAACAATCAGGTACGTGTTTGGATACG
CCTCTTTGCATTGCTGCAGGGCCTTTGCATGTCCAAAATGGAAGAGATCAAAGATGCCGTCGGCGTAAAGACGTAAGGGACGGCCAGTCAAAGTACCAGC
TTCTCCTTCTTCCAGCTTCTTGCGGTAGGGCTCTGGCTGCGGCTCGTCATCGCCCTCGTAGCTGCTCCCACTACTATTGTCATTGGAGCTGTTCACTTCC
AAGTCTCCATCCGCTTTCGTCTCGTCTGCACTTGCGACTGCACCGTGCTCCGCCTCCGCCTCTTCGGTGTTGTTCATCTCAGCGGCACGTCTCTACACCA
AAAAAAAGACATCGGACATACACGACACACAGACACCATATCCATAGTTTAGTACCGTGTCCTTACGCACACGTGTCGACGTACGACCATCTAACATTTG
AACGACCAGCACGCGGTCCGACGTGACGGAATCGCCACGTGAAGGGGGACGAATACGCACCTTTCTCGCCATCTTTCGGGTTACTTGTAAGCTTTGGTTA
TGATGGAAAACAACGCCATGGTCGAGTGATCGGATTAAGTTCGAAAAAAAGGAACGTCGTGCAAAACTGTGACGTGTGAGGAGGGACTCGTCACTCCAAC
ATCACGATATCGGTTTACACAGGAAACGTGGTCGCGAGGATGACAGACGAACGATTGATATGAATACGACACTGCTAGACTGGTCATACACCATCAAATG
TTGTCGATTGATATTAATCGTAAAAAAAGAGGGATACATGAATACGTAGCGTATAATCGTTTGTAGAGTAGCGTTCTTCAGCGCGTCACGACGACGATGA
TAAGTCTGCTACCCGCGTACTGCCAGAATAGAGCCTGTGTGGCACGTTTGCGAGCTGGTGGCGGTCCGTGGCCACTGCGGGCTGCACAACGATCGGTACG
TGCCATTGAAACATTTGCCGCGACGAAGCGGCACGAGTGCTTGGATTCGGCTGCGAAGCTGCTGAAGCCCCTGCTGAAAACTCGAAGCGTAGCAGCCACT
GGAAGCGCACGAGGTCCGTGTTTATCGTTGGTAGTGCATCGTAAGGAATGCTGAAGCGAGCATTCGTCTGCAGTACACCCAAGGTGCGCTCACGGAAGCT
TCCAAAGACGTTGGACTGCACGACGCGTCCGGGTTCAAGTGCTCGTGTAGAAAGAGTCTCTTCGAGACACAGTGTCGCTGATACGTCGTAGCACGGGATG
CTAGCACGCGTGAAGTCAAATATGCCCAATAGAATATCTCCTGGTTGGTAGGACTGTTTTGTAAGCAGGAAACGCACCAGATGACTGCTGTCTTTGCCAA
TTGTAAAGATGCTCGTCTGTGGACGCTGCAGTAGCTCCGTTTCCACGCGGCCGTGCATGAGTGAAGGGCGTAGCTCGAAAGCAAGCTCGCTTCCTTTACG
CACTCCAACGGGTGCCAGTGCTGCCAACGAGGCAAGTCGTCCAACACGAGTCGTGCCACCCACAGCCTGCTGCTGATTAGCCGTCGCCTCAGCACTCTTG
TCAACAGCCAAATCTTCACAAGCGTCCGTGTCTTGACTCACTACTGGATCAGTCGCACTAGCAACTGTACCAGCTTCGAACAAGTACTCGGGGCCATAGA
CATCAAATGGCAAGTGTATCGACACTGCTTTAGTCCCAGGACTTGCACCTTGCACTGTGATTGAGACCAAATAAAAGACACGAGCAGAACTGCCGCGGAA
GCTCGGGCACATGTTCTTGGGCAGTGCGATAGCAAACTCCCGCATACAGCGCTTTGCCGTCTCTTCTCGAGCAGCTTCGAGTGAAACAGCCACGGACGCA
GTATCAGCACTAGCTCCATGGCTCTTCTTGCTGGTACTTGCTTCAGTGTTGGACGGAGTTGGTGCAATATTCAAGTCCGAGAGCAGAACTGACGGTCCTG
AGCGGAAAATGCACGTGCCCGTGTCGCCCGAGAAGTTGCGTACATCGGGTAATGACGCGTCGATATTGTCCCCCAGAAGCTCGTGCTTGGACATGTGACG
GTCCAGTCTTGATTGTTCCTCATTTTTTGAAGCAGCACCACGAAGGGGTGACTGCAACTGCACGACTGGAAGCGTCAGTAGATTACTATCCACCGCAATG
TGGCCGTGGACTTGAGCGATGACGTATGAAATCTCCGTATGTGCATCAGAAATCTGCTGACGAGTTGCGAGTTGCACGAAGCCTTTGACGACACCTCCAG
GTCGGAAGTAGCGGCTTGCCAGCTGAGCAGTGAGTGTGCTGCCATCGCTGGACTCGACGACGTGG