Description :
From Genome Similarity Track
Location :
Scaffold_90:323456- 325633
Sequence
2177 bases(100 bases per row)
TATGGCTTAAGCAAGTCAACATAGAAGACCGGATGCGTGCGCATATTCTTCGGAAGGTTGAGCGTATACGCTAGGCCCTTCCTGGCCACGACCTTAAATG
GTCCTATGAACCGAGGTCTTAACTTCGTTTTGAAGACTGCGGACACTGCATGAGTAGGTAGGTTTTTAGCGTTTAATAAAACTTGGTCTCCGACCTCAAA
CCTCTCAACATTGCTTCTGCCCTTGGCATCTGCATGTTCCTTCTGCGTGTCTTGGCTTTCAGCCATAGCGTCGCGTACTTGACGCATTACGCTCAGTCTC
AAAGAGACAAAGTCATCGACTTGCTTGCGAACTGCAACAGGGCTGACATCAGCTAGCCGCTCGGCTATCCCTCCCCCATCAAGCCCTGAGCCACTGCGTG
GCGGCGTCAGTGGGACGCGAGGGTGACCCAAGCCGTTCACATAGAACGGAGTATAGCCTGTCGAGGCGTGCACTGCATTATTTAATGCGAACTCAACGAG
TGGGAGCATCTGGCTCCAGCGTTTTGGCGCCTCAGCGCATACGCTTCGGAGGGTATCCTCCACAACGCGATTCACGCGTTCGGTCTGACCATCGGTCTGC
GGATGGTCCGCTGTGGACATGTCCAAACGAGTGCCGAGCACTCTGAAGAGGGACGTCCAGAACTTCGCGGTGAAGCGCGGGTCTCGATCCGTGACAATTG
CCTCAGGCAAGCCATGTTGGCGAAAGACGCGGTCTAAAAACAGCAAAGCTGTACCTTCACCATCAATGGTGTCCGGCACTGCCGCTAAATGAGCCATCTT
GCTCAATCGGTCTACAAAGACCACTATACCCGTGTTTCCCGCCTTATCCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAACATCCCTTG
GGCACAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTTGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCGACCCACGTATACA
TCTTGGGCCACCAGTACATCGATCTCACCGGGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATAGAGGATTCGATA
CTTTAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGAGTTGGTGCTGTAGTACAGCAGGCCGCGATCGAGTGAGTATCGATGCAGCCTC
GCGCGTAAGCGCCCAGACAATTCCTTGTCAGAGTCTCTAAACTCTTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCTC
CGCGTATCAAGTCAGGCACTGACGACGTCACTGTCGTGACATGAGCTAACTCGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCCC
CGGCTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGAGAGATGAGACGACTGCGTCGCAGTGCGTAACGAC
GCATGATCAGTAAAGATCACAAAAGGCTTAGAGCCTAGCAGATGTACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAACTG
GATAGTTCTTCTCGGCAGCTTTGAGCTGACGAGACTCAAACGCGATCACGCGTTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAA
ATCGGAGGCGTCACAGACGACGCTAAACGGACTATCCGGGTCCGGTAGCGCAAGGATCGGAGCCTGGAGAAGGCTCTCCTTCACAGCCTCAAAGGTTCCG
TCGTGCTCGACGTTCCAGCACCATGGTGCGTCCTTCTTAAGGAGATCTGATAATGGCCGAGCCATCTCCGCGTAGTTTGCGCTGTACTTGTGCAAGTAAT
TGGCTAAGCCTAGCCACTTGCGTAAGTCCTTTTGGTTCTTGGGAACCGGCCAGTCCACGATGGCCTTGACTTCGGCAGGATCTGCCCGTAAGCCTCGCTT
CCCAATGAAGCACCCGAGGAAAGGTATTTCCTCCGCGCCAAAGACGCACTTGTCCAAGTTGGCATACAACTTATTAGTGCGCATGCACTCGAGCACCGCT
CGCAAGTGGTCAATGTGGTTTTCCACGTCTGACTTTCCGTGGTCAGCACGCCTATGGACGAATATATCGTCAAAGTA