Description :
From Genome Similarity Track
Location :
contig_38:323386- 324812
Transcript NameFunction/comments
g8378.t1hypothetical protein

Sequence
1426 bases(100 bases per row)
TTCAGTCTACGTGGGTGAATGCGGACTACACGGTCAAGGTTGATGCTGCCACGACGCTTACAAGCTCGTGGGATGGATGGGGAACGTCGCTCTGTTGGTG
GGCCAACGTCTTCGGAGATCGCGACGACATTGCTGACCTACTTTTCACTTTAAAGGAGACGGTGACGTTGAACGGCTCGACTACCGGCCTTCCGGCTTTG
GGACTCACCATCGCGCGCTACAACATCGGAGGATCTGCCAGTAACGTCGTTGACGACAGTGGCACGGAGGTCTCCATGCAGACTTCGGACCAAATGCCGG
CATTCAAGTTCATGGATACCTTTTGGCTGGATTGGATGAGCGATGACCCAACAAGCACGAGCTGGAGCTGGGACGCAGATGTGAAGCAGCGTACAATGGT
TGGCCTGGCCACTCAACGTGATGTCGACATTGTCGAAGCCTTCTCGAATTCGCCGCCGTGGTGGATGACGAACAACCATGCTACTGCAGGTGGAGACGAT
GGCGATAAGGACAACTTGTCCGATTGGAATCACGATCAGTTCGCACTGTACTTGGCCACTGTCGTTAGTCATGCCAAGACTAGCTGGGGCATTAACATTA
CCTATGTCGAGCCCTTCAATGAGCCCATGAGTACGTGGTGGGAATACCCAGGTGGTCAAGAAGGGTGTCACTTCGAAGTGGACACACAAAAGGACGTCTT
GGTTAGACTGCGAGCTCAGTTGGACACCCTTGGCCTGCAGGACGTAGCGATTTCCTCATCCGATGAAAATTCGCCGACGCAGACACTGTCCACACTCACC
TCCATGTCGACGGACACAGATGTAATGGCTACCATAAAAAAAATTAACACTCATGGTTACGACGGCCAGAGCCCGTACCGAGGAGGGGACCGCGGCTCCT
TGAAAACGCTGGTGACCCAGTCGAATAAAAAGTTTTGGGACTCGGAATACGGCGAGGACGACGCGACCGGGCTAAGTCTGGCTGAGTCGATCGCACTCGA
CATCAATGAGATGGGTGTGTCGGCTTTTGTGTATTGGCAGGCACTGGACAGTGGAGCTTGGGGTCTTGTTCAATCCAACCCGGGCGATAGCTGGATTGGC
ACGCCCAATCCAAAGTACTACGTGTTGACCCAGTACTCGCGACACATTCGACCCGGTATGGCTATCCTATCAACAGATGACACGAATACCGTCGTGGCTT
TTGACGCCGCGTCGAAGCTTCTTGTGGTCGTGACGGTGAACTCGGGCGACTCGGCATCTGCGGTCACTTTCGACTTGTCCAGCTTCACAACTGTGGGAGG
TCCGATCACTGCCTGGACGACGGAGACGAGCGGCACGGGCGCGCTGCACGAGTCTTCGAAGGTGGTTTTGTCAGGCACGTCATTCAGTGCGTCGATCCCT
GCTGCGTCGGTCATGACGTTCGAGGT