Description :
From Genome Similarity Track
Location :
contig_38:323382- 324808
Transcript NameFunction/comments
g8763.t1ETI37636.1 hypothetical protein F443_16390 [Phytophthora parasitica P1569

Sequence
1426 bases(100 bases per row)
TTCAGTCTACGTGGGTGAATGCGGACTACACGGTCAAGGTTGATGCTGCCACGACGCTTACAAGCTCGTGGGATGGATGGGGAACGTCGCTCTGTTGGTG
GGCCAACGTCTTCGGCGATCGCGACGACATTGCTGACCTACTTTTCACTTTAAAGGAGACGGTGACGTTGAACGGCTCGACTACCGGCCTTCCGGCTTTG
GGACTCACCATCGCGCGCTACAACATCGGAGGATCTGCCAGTAACGTCATTGACGACAGTGGCACGGAGGTCTCCATGCAGACTTCGGACCAAATGCCGG
CATTCAAGTTCATGGATACCTTTTGGCTGGATTGGATGAGCGATGACCCAACAAGCACGAGCTGGAGCTGGGACGCAGATGTGAAGCAGCGTACAATGGT
TGGCCTGGCCACTCAACGTGATGTCGACATTGTCGAAGCCTTCTCGAATTCGCCGCCGTGGTGGATGACGAACAACCATGCTACTGCAGGTGGAGACGAT
GGCGATAAGGACAACTTGTCCGATTGGAATCACGATCAGTTCGCACTGTACTTGGCCACTGTCGTTAGTCATGCCAAGACTAGCTGGGGCATTAACATTA
CCTATGTCGAGCCCTTCAATGAGCCCATGAGTACGTGGTGGGAATACCCAGGTGGTCAAGAAGGGTGTCACTTCGAAGTGGACACACAAAAGGACGTCTT
GGTTAGACTGCGAGCTCAGTTGGACACCCTTGGCCTGCAGGACGTAGCGATTTCCTCATCCGATGAAAATTCGCCGACGCAGACACTGTCCACACTCACC
TCCATGTCGACGGACACAGATGTAATGGCTACCATAAAAAAAATTAACACTCATGGTTACGACGGCCAGAGCCCGTACCGAGGAGGGGACCGCGGCTCCT
TGAAAACGCTGGTGACCCAGTCGAATAAAAAGTTTTGGGACTCGGAATACGGCGAGGACGACGCGACCGGGCTAAGTCTGGCTGAGTCGATCGCACTCGA
CATCAATGAGATGGGTGTGTCGGCTTTTGTGTATTGGCAGGCACTGGACAGTGGAGCTTGGGGTCTTGTTCAATCCAACCCGGGCGATAGCTGGATTGGC
ACGCCCAATCCAAAGTACTACGTGTTGACCCAGTACTCGCGACACATTCGACCCGGTATGGCTATCCTATCAACAGATGACACGAATACCGTCGTGGCTT
TTGACGCCGCGTCGAAGCTTCTTGTGGTCGTGACGGTGAACTCGGGCGACTCGGCATCTGCGGTCACTTTCGACTTGTCCAGCTTCACAACTGTGGGAGG
TCCGATCACTGCCTGGACGACGGAGACGAGCGGCACGGGCGCGCTGCACGAGTCTTCGAAGGTGGTTTTGTCAGGCACGTCATTCAGTGCGTCGATCCCT
GCTGCGTCGGTCATGACGTTCGAGGT