Description :
From Genome Similarity Track
Location :
Scaffold_79:32337- 38006
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_79-fgenesh-gene-0.7Glutamine cyclotransferase
Pytir_DAOMBR486maker-pir_contig_79-snap-gene-0.46U6 snRNA-associated Sm
Pytir_DAOMBR486maker-pir_contig_79-snap-gene-0.33COMM domain containing 2
Pytir_DAOMBR486maker-pir_contig_79-fgenesh-gene-0.20Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_79-snap-gene-0.34Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C
Pytir_DAOMBR486maker-pir_contig_79-fgenesh-gene-0.21Phosducin

Sequence
5669 bases(100 bases per row)
GTCCAGGTGCTCGCAAAGTATCCGCACGACTCCGAGGCGTTCACACAGGGTCTGCTGGTCGCGAAGCAGGGTGAGAGCAAGTTCTTCATCGAGTCGACAG
GTCTGTTGGGCAAGTCGACACTACGCAAAGTCACGATCGAGACCGGTGAAGTGCTGGGCAAGTACGATCTGCCGAGCGAGCTCTTTGGCGAGGGCGTCGC
GCTCACGAAGGACACGGGCGAGCTCGTGATGCTCACGTGGAAGAGCCGCAAGGGTTTTGTCTTCCAGGCTCAAAGTGATGCGAGCGCTCCGTTCACATTG
GAACGCGAGTTTGAGTTCAGCACCGTCACGGGCGAAGGCTGGGGGATTGACTCGGACGGCGACTCCCACTTGATCGTCTCGGACGGCTCGGCGACGCTCA
TGTTCTGGGATTCAGCGAGCCTAAAGGAGGTGCGTCGCATTGACGTGACGTTCAGAGGTCACCAAATCGCGCAACTGAACGAACTGGAGTTTGCGAACGG
CTTTATCTACGCGAACATCTGGTACGAGAAGCTCATTGCGAAGATCGACCCTGCGAGCGGCGTGATCGTCGCGGTCTTTGACTGCAGCGCACTCGCGGAC
GCGCTCACGACGGGGGACAACCAGGGTGCAGTGTTGAATGGCATCGCGTACGACGGCGACGAGGACGTGTTCTACCTCACGGGCAAGCTCTGGAACACGG
TCTACAAAGTGCGCTTGCTGGAGTAAATGGACAGTGCTCACCGTCTGTGTGTTTGCGTGTGATTTGGAGCGGTGAGCCATGGACCATGTAGCCATACAGC
TCCGTTAGAAAAGTGAAAATTGTGTTTGAAGACCTCCATGTCTATGCTTTTCGATCATTTTTTCTTGTATTTTTCTGGTCTGAATATGTTTCGTGAACGC
GCTCTCGTAGCTATCACCACGTGCTATCAGCTCTTGCGTTACGGTCGCATTTTCTGGGAACGCCGCGCCACTATTCTCTTCATTGCTGCTATGCTTGCCG
TATTGCCATCATTTTCAATGTTGTTATTCTTGCCGTATCTCCATCGCCGCATCTCTACTGTCCGGTCTTTCTGTCCGTGGGTGATTGCATCTATTCTTCC
TGCTGCAGGAACGGGTTCGCAATCTCCTCAGTGCCGTCGACCGGCGAGATGAGCATCACGGACGTGCCTCTGCACACCACGAGGCCGATCTTGCGCGTCT
CCTCAGTCAGGCGGTACTCGTCGCTCGCGTCGCGCAGGAACTCGATGCAGTCGTCCAGCACGAGGTTCACGAGCTGGTCGTAACCCTTGAGGAAGCCGTG
CACCTCGCGACCACCGTGGAACTTGACGCGCACGGGCTGGTCAATGTACTTGGCGAGATCCAAGATCGGATCCTTGCGGCCGGGGGCTGAGCCGCCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGAGGTAGTGGTGCCGTTCGCTGCCATCTTCGTCTGCTGCCTCTGTTGCTGTTTGCCTTGCTTTGTG
TGTGAATGTGCTTTTGATTGAGGGTTCTTGGTCATTTGTCGCTCTCTATTTTGACTGGCCAAAAATAATATTTGGATACGTTTTAATTGAAAGATAATAA
CTTTAGATATCTCATTGGCCAAAATACGCCTGTGATTTTCAACAGCAAGCTCAAGAGCGGATCCATTTTCAGTTGAGCTTGGCTCGCAAGAACAAAGAGC
TTCACACAAGAATGAGCCGCAGCATGACCTGGGACGAGCGCGTGCTGGACGCCGTCGCGCGCGTCAAGGAGATCCCGCTCGAGCGTACGAGTCCCGTGCG
GTGGATGGAGTGGTGTGGTATTGCTATGTAGAGTCACTGATCTCATGTGCTGTGTGCTTTCCTACGTGTTTGAGCAGACTTTGAAGTTGTGAGCAAGATG
GCGGTGATGCTCTTCCAGACAGAGAAGCAGAGCAAGAAGCGCCTCACGCGCACAGCGTGTACGTAAAAATGCGAGTGACGACTAGTTCTATGTAAGCTGT
GCTGATGGCTGGTGTGTCTGTGCTCTTCGTCAATGTAGCGGCTTGCGGCTGGGATCACCATGTGATGGAAGAGACGGTGCTCGCGGTCGCCAAGATCTTG
ATGGACGGCGCCAAGGTAAGTCCTCAATGAAGCTCACGACTCGCTGGGCTACGATTCAGCGTGTTGATGTGAATTTGTGTCTAATGTGCGTGTGTCTGTA
GGCTGAGCTGTCGGAGTACCACTTTCAGGTGTCCGTCAAAGGCATGGACCTGCCGGAGGAGCACGCTGAAGTGCTGACCAAGGCAATGCGGTGCTTCCAT
TCCTGTCCACTTCACACCGTATGCCCATGCTAAACCTTGTCATCCTACTGTTTATTGCGTGAACATAGCTGTACCTAGAGCACGTGGATGTGATCAAAGA
GAGCGTATCCCGCGACACTGGCACCAACATCCCGCGCTACCAGAGTCTGGACTGGCGAATTGACCTGGAGGTAATACCTGGCAAATGAACCAAATGACGG
CCACTGAGTAATGCTGTCATGGCTCTAATTGCTCGATCTCCTCATCCTCTTCACTACGGCAGGTTGGATCACGGTTCATGCGCAACAAACCAAAGTCGAT
CGTGACGCTTCGTCTGGACTCGGTCCTGCAGCCGAGCAGCTCCGATTTGCCAGAGCGTCAGTCCTCCTGCATGCGCGTGGACTACGAGAGCCTGCGCAAC
CTGCAGCGACAACTGGAGACCGCGCTCAAAGAAGTGGATGCGACTCACGCGAGCCGGATACAACGATACCTGCGCTAAGCGAACGTACAGTAGCTCTTCG
GCCAATGTGCGGACACGGAGGGATGAAGAAGAACCCACAAGCTGATCGATCGCCGAGCAAATTGCATACTGCATTTCACACTGTTGTTAAGTTAGGAAAA
AAGAGAAAAGAGCTAAAACGAGGATACGGCTCAACTCAGCACATTTGTTCTACAGAGACTGCGTGATACACACAGGATATCCTCTCATCTGAGCCGATTA
ACGCCTAATGCCCCTACTCTCTCTTTGCGAAGGCAGTCACGTCGTCGAGCTGCTTCTGCGACTCGTTCGAGATCACGTCTCTCTGCATGAGCAGCTCCGC
GAACTTCGCCTGGTTCTTTCGTCGTCTCTCTGCGTCAGGCTTTACTTTCGCTTCCTGTAATCACACGAACGCATCCACACAAGGCAATCAGCACTACAGT
CAGCATTAGCAAAATGAGTGGCGCACAGACTGGCGCCGCTGTCGTCCGTCGGCACATGGACAAGAGCGCTGATGCGCCTCTGAATAGTGCGACGATGACC
AGGCGCACGCACCACTGCTTTGCGGATGTCGTCGTCGGACTTTGGGTCCCAGTACCAAAACGCCACGGCCGATGGCACCGTGAACATGAGGCCGTAGTGC
AGCAGCATCTTGGGGATCTTCATGCTGGCTAGCTTGTTGTCACGCGCTGATGCCAATTAGGAAATGGTCAAACACGCGAACTTAACGCAATTTCATTGCA
ACATCACGTGGAATTTCGGAGAGCTTTTAAGCGCCAAGTATCCATTAAGTTTGACTATTGACACACAACAGATCTGAATGCGCACTTAGTGTATCTTTGA
GCTCTTCGTGTGGCACTTGAGTGGCGAATAATCCGATCTGATGGCGACTTCAGCGATGGGAATGCGCCGATTGCTACGCGCCGCCGCCGTGGTCACGAGC
CGCCGCTCTGAGCTCTGCAGTAGCGCTCGTGTCTGCGCACTCAACTACAGCACTAGCGCACTCCCAGCGGGGCTCACGGAGATCTCGCGTGTACGTTCTT
GGCTCAGCGTTGACAATCGTGTGTGTTTGGCACGTCTGACAGTCTTGCTCGCTATTGTTTGTGTGGTGTGGTGATGATGGCTCGTGAGTTTAGATTCGGC
GCAACCCGTCGTGGTCGCTGAAGGAGCTGCACCACGAGGGCGACCTGGACGAAGCGGAGAGCGTGCTAACCGAGGCAAAGGTGCGGTACTTGGCGCTAGC
TAGTATGTAGCGGTGATGAATGGCTTTGAACGCTGTCCTCACGTTTATCTCTTATCCTAGCTGCGCGAGCTGGCGGAGCTGTGCCATCTGCACATTGACG
ACGCCAAGCTACCGTCGCTGCTGAAGGACGTGGAGTCGATCATCCAGTGCACGAAGACCATCCAGGCGATGACGCTGAACGAAAACATCGACGACCTCTA
CGCGAAGGACGACTTCGACTCGAGTGCGTGAATTAATGGCGATGCTACTTGGTATTTGGACTATGGCTAACTGACGGATCGCTTCCTTTTTTTTGCTCTG
ATAGGCATCGCGCCTTTGCGTGAGGACGTAGTAACGGATGGCAACTGCGCAGACAAAGTGCTTGCGAACGCCGCAGAGAAGTCGGGCTACTTCTTCAAAG
TCCCCAAGGTGCTGCAAGACTAACGCTCTACGCTCAATCACGCCAAGTTATAGCAACCGTGTGAGCAATAAAAGCAAGCAATGTATAACCAACACACAAG
AACACGAGTAGTAACGCTAAGAAAATCTATATTCACCGGGTCAAATTGGTGGTACATGAGATAGCAACTGTTTAGTTGTCGGTCTTGAACACACCGGATT
CGGCGAGGCGCTCTTCCAAGTCTGCGTAACGCAGCAACACAGCAATAACAGTGCGTTAGATTCGGAGATACAGCCCGTATTCAAATAGAGAAAAGCGCAA
TGAGCTGGTGACGATGGCCACGACATACCTTCGACCTTCATGTCTAATCCGCCCAGCTTGCGGATGCCCAGTACCTGGTTCTTCAGCTCGCCCTTGTGGT
ACATGAAGAGCGTTGGGCAGTTTCTATAAGGCACAAGGATGAGAACAAGGTGAGTACCCGCTTTGGTGTGAGCACGAACAAAACTGGAAGCAACATTCAG
AATCATGACAATCAATCCACATACCGCTGTGGCCAGTTCTCGATACACGCCTGCGCTTGGATGCTCACGAACTTGACGTCGCGGTGGTTCTTCGCGACCA
CGCGCAGCACGTTGTCCATGAGCTTGCACTCCTCAAGCGCGTCGTCCCACAGGTACGCGATGACCCAGTTCTCCTGGCTGCTCTCGGTCACTTCGCGCGT
CCACTCGTCCTTGGCGATCGGCTGGATGTCCCCGAACTTGGCGCGCTCCATCATTGCGCGCATCTCCGCAATGCGGCGCTCTCTGTTGTCATTCAACGGT
CACACGAACAATGGGTAAGTCAACCATTCCCTGTCATTTTATCTGCTGCAATTTGGGGCATGAAGATCGCTGCGGTGCCTACCTAATGCGCTGGAGCTCC
GAGTCATCGTCATAGTCATCCTGTCAAGCGCATACACAGCAATACAACATGCGCATACCCCCAGGTTAGCTTTGCAGCGTACTGTTACATGCATAGTATA
CAGCTGCGTAGCTGCTACTGCTGCTAGGATGCAGTCAAGCAAGCGCCGCGCGGTTGTGCTGTGCGATTGACGACGTACCTCCATCTCGTCGAGCTCGTCG
AGCGTCGCATCTTCGCGCGCGTCATACTGTTCGTCCTCGGACTCCTCCTCCTCCTCCTGAACCTTGGTCTTGGGCGCGAGGATGCCCTTCTTGATCAGGA
TGTCCTCCCACTCGGTGGTCTCGCCTGTTGGCTCGTAAAACTTGCTCCCGCGGTCCATTCTTGCTTCTC