Description :
From Genome Similarity Track
Location :
Scaffold_76:32335- 46242
Transcript NameFunction/comments
Phypl_g2519conserved hypothetical protein
Phypl_g2520hypothetical protein
Phypl_g2521conserved hypothetical protein
Phypl_g2522hypothetical protein
Phypl_g2523conserved hypothetical protein

Sequence
13907 bases(100 bases per row)
CGCAGCGCAGCGTGAGGCTATCGATCAGCGCAACGTTTTGGCACTCGCGCAAAACTGCAACAAGTCGGCACGAAAGCGCAGCTCGAGTACTTGTATTGTG
TACTATTGAGTCCAACCCTCCACTTCACAACTTGAAggtgtcgacgctgaagTGCGCGCACGGTCGAGAGCGGCAAAGACAATCAAGGAAGTGTACATAT
CCGTGTGCAAATCTGCGGGATCATGAGGAGAAGCAAGGTCGGCCAGCTGACAGGCACTCACCCCCGGCTGTCATGGCCGAGATCGCGGCAGCCCCTTTGT
CCCACAGTTGCTCGCGTCAGCAACgatggggggggggaagCCAAGCTGACTGCCTCACTCTCGACTTGGCGGCAAGGGCATCACCCGACGCCTTCAGTTA
AGCCAATCTACCTCAAAGAGACGTGCGTGCTCGACCCGTGGCTACAGTCACGATGCCTCGGCaggactcgagcgcgtcctTTTCGGACTCGAACTCCTCC
GCCCGGTACGCTCGGAACTGCCCTTGACTTGTGTGTCGTGACGACACTGTCGTCGTATGTCGTCGTATCCAGTCTTCGTGTCCGACGCAGCGTCGGCTGG
ATACTGCGACATTCGTAGCTTTTAGCCTCAGTCACTGACCGTCGCTTGCTTCTCCCCGTTCCAGCGATCCCGCCGACGTCATGCACGACAACGGCGGCCA
CTTCCCGCTGCCCGACAACTACTTCCCGGAGATCCGCCTCACGCCCAAGGACGTCAAGAACTACGAGTCGCAGATGCAGGAGATCGTCAAGAACGCCTtg
gccgagtacgagctgcacgaggccaAGGGGGTGTACCCCGTCTATCGAGCCCCGTGGAGTCTCGTCGGCAAGGTGGAAGGGCTCACGaccatcaagaagg
agacgccTGACAGCCCCACGGCCAGCCAGGCGCGCATCTTCGGCCGCATCAACGGCGACTACCGCCACTTCATCGACTTCTTCTACGCCGAGACGTCGCC
CGAGCTGTTCGCCTGGAACCAGTTCATGTTCGGATacgccacggacgccgcgGTGCTCAAGAACATCCACACGGTGGCGTCCAAGCAGAAATGTCTGTAC
ATGGGCATCAAGTGGACGTGCCTGAGCCCGTCGCCGctcgtcaagaagcgcgacAACTGCTACATGGAGTACCTCATCTACATGAAGGACCTGCGCGGAC
GCGACGTGGGCGTCCGTGTCACGCTTCCGCTGGACATCCCCGAGTGCCCCGATCTGCCGAAAaagctcaagacgaagcGCATCCGACTCAACACGGTATG
GATTTCGAGACCCGCCGACCGCGAGCCCAACGTGACCGAGTTCTTCATGCTGTCCCGGAACAACTTTAACGGCCTGGCTGTCACGGCCAACTACTACAAG
CGTATGATGAACATTCTTATGAATATGGCGGTCTTCGTGGACTCGCGACGCATCCTGATGCAGGGGGTCATGCAGCGGAAGAGCTGGGCCAAGTGGGGCT
CGCgcaaaagctgcagcgtgtgctcGCGCAAGTTCGGACCGacgcgccgtcgccaccactgccGACTGTGCGGAGACCTCATTTGCCGGCGGTGCGCCAT
CGTACGTGACGCCcccaaggaggacgacgcgtcggCGGGATCAAACAGGACGTTCGTGATCGTCAAAACGAAGTTTTGCGTGCTGTGCGTGACGAAGATG
CGTGAATCCCGCAACAACATGCTGGTGCCTGCCCCGAGTGGCCAGCTCTCAGTCATTGACTGTGACTATGACGATTTGGATCTGGACGAGTCTCGCCACT
CTGCGATTTCCGAGACGGAGTCCGAGGGTGGCCACatttccttcttctccgagaCGGGAAGCAGCGAAGGAGCGCGATCACTGCAACTGTCACCCCAGTC
GACTTCGATCTCGTCAAGTATCGGCAAAATGTCTTTCGTCTCAAAGCTCGACGTGATCGACGATCAGTCCGTGACGATTCTGGCCGACCCCAGAATGACC
ACCAGCGAGCTGATCGAAGAGGATGTGGCGGAGGTCATCGACACGACGGACATGGTGCCGGTCTCGTCGCTCAACTCTTCAAAGCGGGGCGGGAGCTCCC
CAAATCAAGATGCAGACGAAGGCAAGACAAGCTGGGGCAGCGGCTCCAGTTGGTCTCCGTTCGGTTCCAATACCTCGCCGCGGTCGCTGGACCAGTGCCT
agccgagcaggaggagctgctgcgccgcatgATGCTATCGGCCAGCGGTATGCACCGCCAGAACGACGCGAACCCTGGGAGCGGGGCCATGGGTAGCGGT
TCCTCCGGTGGCGTCCAATCAACCAGGTCTCGCCCCGATGTTACGCTCTATGAAGGCTAAGCCATACGTACCAGTAAGCTACACGCCGCAGTCCTGTCTG
CAAGAAGCATTATAAACCTAACTGTAAGTAAAACTTGTTGGAACGCGTAGTCTAACCGAAGGCCATGTTGGTCCCACTCGACACATCGACCTCGGTGCTC
AGGATCGAGTTCGAGATCGGGGCGACCTAGCCATAGTCGGTGTAACGTTACCGTACTTCCGGCGCGGAACCGAAACGCTGCCTTCGCGGAGGAATGGTGC
CTGGCCTGCCTGACCTCAAGAGCGCGAGCCTCAACTTTCCGCCTTCAAAGCCACATTGACGATCCTGTCAGGCTTAAGCCACGTGTCCGGATTGCGACAG
CTTCTCAGCCACTTGATGATGCCTCCGCCGAGGTTCTTCAGAACCGTTCCTGGTTGTAGCGGTGccgcgatgaagaagccaTTTCATCCACTGCAGGAAG
GAGCAACTCTTGGCAAGCGACCCGATCCACACAAACACTTGAACCGGCTTCCGTGAATGGGGTTAGCCGGTTCAAGGTCGCAGCTACAAACTGCACTTGG
CTGCTGTATGAAATCCTGAGACGCGCGAGCGGATCGAGGCTCACGATCCTTCGATCAAACGAGCATGCCGGCGCTGTCTCCATCAAACGGCATACTCGAC
CGCCTTCGTGCCATACAAAGGAAAGTTCTGCAACCAAACAGCGCCGTTCGGCCTCCGCAACGGCATATTCAACTCGCCCTCGCGAAAAAATCAAGCCACT
GCGTTGCACGACCGGCGGGCGTGAGTGCCTTGGTATCGCAGCCTCATCGGATGGAGCCCACTCGATCAACACTTTCTCACTTGCCAGGCGCGTCGAGTCG
CTTGTCGTTCACTCGGTCCGCCGTACCAAGAGTGGCTTAACGCTCCACGACCGAACGACCAAGCAATATCGCTCAAGACGCACGGGTTGTTACTCCCCAA
TTGACGCCATGCCCCGCAGGTCGTCGCCCTCCATGCCGCGCACGGCCTCCGTTAGCTCCACGACTTCATCGTAAGTCGCATTCCGGCATCTGCCTGGCCG
TCACAGCTTTCTGGGGTTGTGACTGCCGTTCCGGTGCTCGTCACGCTAACGCACACCTTGCTGTTGCAGATACCGCGCCGGCAAGCTCCAGTTCCCTCTG
CCAGATGACTATTTTCCCCCAGTGACCCTCGCGCTGACGCAGGTGCAGCAGTACCAGGCCCAGGCGGAAGAAGTGGCCACCAAGGCGATGGAGTCCTGCA
GAGAGCACGAGAACCGAGTCGCCGGCTTCGGCCTGGAGGAAAAGCGCTGGCAGGACGTCGTCCAGGACTCGGATCTGTCCATCGTGCGCCGCAAACAGGG
CGCGCTTACCATCACGCGCACGTTCGGAACGGTCACGGGCGACTTCCGCCGGTTTGTggacttcttctcgtccgagacgtccgagcagctcttcgcaTGG
AACCAgttcttcttcggctgcgctgtggacgccgtcgtgctgtgCAATCTGGACCTGGACAAGTCCGACAAGCAGGCGACTCTCGGGATCAAGTGGACCT
GCATGCAGCCTTCACTGCTCACGCGCAGGCGCGACGAGTGCTTTCTGGAATACATTGTGTTTAGGAAGGACGACCAGGGCCGCGACGCTGCGGTCATTGT
GCGTATGCCTGTGGATATCCCGGAGTGCCCGTCGCTACCGCACGAGTTGAAGACCAAGCGCGAAAAGATCACAACGGTAATGGTTGTGCGTGAATCGGAC
TTGCACTCGAACGCGACGCAAATATTCATGATGAGTCAGTGTGAACACAAGGGGCTCACGGCTTCCACCAAGTACTGCAAGAAGCTGTTGAAGGCACTGA
AGGATGTGTCACtctcggccgacgccaagcgcaTTGCCACTGCTATCAGCACGCCAGGTTTCGTGGAGCAGTCGCGGGTTGGAGGCGAGCCTTTCGCTGC
GGGAGACACCATCCGGCCCTGGGTACCCACAGGTGTCCACCAgggctgcacgagctgctctcgGCCCTTCCGCGCTGGTCACAGACGCCGCCACTGCCAG
ATGTGCGGCGACGTGTTTTGCTCCAAGTGCCTtgttcgacgagctggcaTTCGACAGGAGAGGAGCGCCTTCAGCACCTATATCACGACGAGCAGCCAGC
GGACATTCCGCGTGGTGCAGTCGCTCTTCTGCAGGGTGTGCGTTACTCGATCTCGTGAGGAAGACGCAGACGCGATCCAAGAGCAGATCGACGGCACTCG
TCGCTCCGTGGCGTCttccaagtcgtcgtccgtgccCCGTCGTTCGTCGATGGGATCTTCCACCCAGCCACCGAGCTCGAAGTGCTCTACTCCGACGTCT
CCGGTGCCTCAGTCCCAGCAGACTGACGCACCTCGCCGCAGCGCGATTTGGAGCGAGGAGAATCGCGCGTCTTGGTGGTCCGAGAACGAGTCGGACACGT
GCAGTTGGAAGTCCGGGTCTAACCGATTCAGCACCATCTCGCGCAACCACAGCGGGGCCCCCACCGTGCGCTCGTCGCTCAGCTCCGAGTATTCTCTGGG
CAGAAACTCCTTCCTGGCAGTGCAGTCTCTGGAGACTCCACATGAGATCGATGCGGACCGGCTTGACGACCGCATCGACGAGCGCTCCAGTATCTACGAG
GTGATCGACACGAATGACATGGTGCCCGAGTCCGAGCTTCAGAAGCAGCTGCGAAGCCAGCAATCCTCTGTTTCCGAGTCGCCGGACTcagccgacgacg
acttcttcggcGACTTCCCCGACACCGGCGCGCGTACTCGCTACACGTCCACGCCGGTGGCTCCAACGTTTTTGCCGCCGCGCCCAACCGCTCGgcgcac
gcgcagcacggaCCAGGCCGAAAACTCCCCCGCTTCGAAGTCGCTGGACCAGTGCCTCGCCGAGCAGaacgagctcctgcagcaggtgctgtccgcgagc
tgcggcttcgCTCCCGAGGCCCaggcgtcgtccgtgagcCAGAGCATtcacgaagacgacgagggccacgacgacggcgttTATGAGCTGTAACTccctc
cgtctccgtctAAGAGCAGTGTAGACAGAGGCACCCATCGCGAAGACAGCGGTGATAGTaaacaacaacaaccacTCGGCATGCTATGAGCAGAGTACAC
AGGCAACCACCATTTCCATAGACGTATCAATCATTTGGCTGCTGTACATGCAGAGTCCGTGGTGAAGGAGACTGCAAGGTAAGCTTACTAGTACGGCACG
CATGGCATTGCTTGCCAACCGCTGATGGGTACCGAGTGTTTGCGTGGCGAAGCGGACATGCCGATGTGGCACGGAGACAACGCACATGCTTGCTTCGCTC
CATGCTGGCGAGGGTTGGTCGCAAGATAAGTCCGGCAGTCGAGTCTCGAGTATCATCATCTCATCCGATGGCCCCATCTGGTTCAGTTCACATCACCGTC
TGCGTGCGGGACCAACTCCACTTTGAGGGCTGGGCAGCACCTGCATTACTCAACTCGCGCGATGCCTGCAACGTCTGCCACGGACTCGATTCAGCCGTAA
GTtgcgccagcgcttccttcCTCTCCGCATTGTTTCAGCGGCGTCAATCACGCGTTTTGGTTTGTGCCAGGTCCGTCATGTTTGCCAGCAAAGCGAGCTC
GTTCCCCCTGCCCGACGACTACTTCCCGGATGTCCAGCTATCGGCGCTCCAGATCGTTGACCTTGAGGACAAGATGGCGCTCGCGGTGAAGAACGCGTTG
GTCGACTACGATCTGCACGAAGCCATGGGCTCCAACCCGAGCTACGGCAAAGGCTGGAAGACGCTGGGCAAGGTGGCAGACCTCACCACCGTCCGACAGa
acggcgacgccgccgtctgcCAATGCCGCATCTTTGGCCGCCTGCGCGGGGACTACCGAAACTTCATCAACTTCTTCTACGCCGAGACGTCTAGCCAGCT
CTACGCCTGGAACCAGTTCATGTACGGgaacgccgtggacgccgccgtcctGAAAAACATCCACACGAGCGCGTCGGGCAAGCCGCATATGTACCTCGGT
ATCAAGTGGACGTGTCTGCAGCCGTTTGCACTCGTCAAGAAGCGTGACACGTGCTGCCTCGAGTACATGGCCTTCACGAAAGACTTGAGGGGGCGGGACG
TGGGTGTGCGAGTGAACATGCCGCTCACTCTGCCCGAGTGTCCGCCGCTGCCTGACAAGATGAAGACCAAGCGAATGCAGATGCTGATCGTGTCCATCGT
CCGCCCAACCGAGGGGGACCCGAGCTCGACGGAGCTGTTCCTCATGAGTCAAAACGACTTTGCCGGATTTGCCGACCccgggttcttcttcaagagGCTT
ATGACTAAGATGAACGACATGGCCATCTCGGTCGACTCGAAGCTCATCTCGGTCCACGGCTTGATGAAGCGGAACGGCTGggtggccaagaagtccCGTT
CGGAGTGCCGCCTGTGCTCGCGCGATTTCTCGACtacccgccgccgccagctctgTCGGCTGTGCGGCGAGGTGTTCTGTCGACAGTGTTTGATCTACCG
CGGCgcggcgaagacggcgacaGCACGCAGAAGACGTTTAACGTTGTGCAGACAAAGTTCTGTCGCGTGTGTATGGCGAAAGTTCGGGACTTGGACGTGA
CGTTGCTGGCACCGGGAGCACGCGGCAAGGGCGAGgaccaaccagcagcgcttcgcaTGTTCGCGGACTCGGGGACTTCGACAAAGCTTGACGGTGAGCA
CACTTCGTTTGGGTCGTCTGCCGACTATAGTGATGACCTGCGGGTCTTGCCTCGCTCTTCATCCGGTTCTGAACTACTCGAGACGATTCGATCGTCCGGC
GAACGTGATGGTGATGTTGTAGATGACGACCgcagcgagctggacgaggtgagCCAGAAGCCCATGGGCGTCGACATGTCGAACCTCCTGTCGTCGTCCC
GGATCGACGTTGGTGCCtccttcgacgaggacggacCCGCTCGCCAACAGACCAGCAGTTCGGGCAAGCAAGTGTCGAGGCGGACCATTGACCAGTGCAT
CGCAGAGCAGGAGGACCTCTTGAGGCGACTGATGCTCGCTGCCCAAGACAGAGCACAGCCCTAAGGCCCCCCAAGGACGTGCAAAAAACGATTCAAGATC
GCACCGACAGCGGAGTTGTTACGTTGTCATTTCGCGGCAGCTGCACTGGATAGTCGCTCGCACGTGCTTATCTTCGGCTGTTGCCTgcgaggaagagcgc
agTCCCATGTCCTGGTACTGACAAACTCGATCAGAGAGCGTTGATACAAGGGCACAAGCGCCGGGGCGGAACTTGCAGCGGCGGACAACTGCCGCGGATC
GTTACATGTGTGTCTTCAAGCGCCTCGAGCAATTTGAGCTCGCGCCAACGCACCGACACTTATGAGCAACTACAAGTAGACAGACCACTGAAACATGGAT
TCAGTAAAATGGCAATAACACTCCATGGTCCTAACACTACGTGAGGTGTACGTGACTACCCTACAATTCCTGCTGGAGGGGGCCATCGTTAGTTATTTTG
GCTCGCATCATGGCTCGAAcgtttgctgctgtccacgGGCGCTGGGTGGGTAGTACCCGGCGGACGAGTTGGCCGCCATCACCAAACGCTTCAACAGCAC
TTCTTGCTCCTGAAGGCGCTGATCGATCGACACGTTTGATCGCGCCGAGCTGAATAAGGCCTGCTCTGCAAGTGCATCCGCGTCCATCGGCGACTCATCC
AGTGGGGACGACACTATCTGCCGTGTAGTGGAAACGATCTGGTTCGGCTCGTCAATAATTTCGATAACATCGTCCTCCTTTGaatcgtcgtcttcatcct
cctTCATTGGCGGAAGGTTGCCACTCCTGTTGCTTGAAAACCCTTCGTTGTTTGTGTTCGACGGCGAGTCCACGAGACGGACGTTCTTGaagtccagcgc
cgcaagcgATTCTCGCATCGCCCGAagttcctcttcctccacctcctgcaccacaCGCTCCGCGCCAGCCATGGtgcggaggtggcgcagatCGATCATC
ATAGGAGCAACGGGCTGCATGACCTCGacctcgatctcgtcgtcctgtGAAGACGACACGCTCGTTTTCGTCTCTGATTGAGCCTCCGAGTcgatgctgc
tcgagaatTTTCCTTGCGGCAGACTCGTGCCTTCGACCGCGcactcgtcgtcttcagagtcctcgaccagctctATTTGCGGTGGAGCCGAGCGAGCCGA
GCTAGTGTTATCTGGCGAAGGCGATGCAATCGACGACCCGCCTGTCATCGTGAAATTGTTCTCGTTGTCAAAGCTTCGGCTGCGAGACTTGTCCATGAAC
CAGCCCGTAGACTCCGCGTCGGACGCTCCTTCGTCCTGGCTGTCAGTCGCCGGGGGATTGCTGACGTCGGAGCCGCGAACCTTGCTCATGCAGGCCTTGC
AGAACATGGTCTTCACCACCTGGAACGTGCGAAGggtcgaagaagcgccgTCATCAACCATCGGGGCGTCACGAATGATCAtgcaacgacgacaagccAC
CTCACCGCAGAGGCGGCAGTGCTGACGGCGTCGCGTTGTCGAGAATTTGCGGTTGCACACGGTGCAGTTGgcgcgcgccttcttcgacgcCCAGCTTCGG
CGATCCAGCATTCCATGCATGGAAATGCGCTTGGAATCGGCGAACAACGCCATGGAGCTCAACGTGGTCATGAGTTTCTTGAAAGTGGCAacggaggacg
agttcgacccCAAGTACATGTCGACCTCACTTGTCATGAAGATCTGcgtggcgtcggtgctgtcgctcgtCGCGGGGCGAACGATGGTCACCGTGTGCGA
GTGAATTCGCCGGGTCTTAAGCTTgtccggcagcggcggacACTCGTCCAGGAGCAGAGGCAGCGTGATGCGGACGCCGACGTCTCGGCCCTGCAGGTCC
TTGGCGTAGACGAGGTACTCCAGGAAGCACATATCGCGTTTGCGCGAGAGAGTGGAAGGCTGTAGACAGACCCACTTCATGCCCAGGTACTGGTGGGGCT
TGTGCGATTCTTTCGTGTGGATGTTGCACAGCACCGCGGCATCCACGGCGTATCCGAACATGAACTGGTTCACCGCGAAgacctgctgcgccgtgACCGA
GTAGTAGAAGTCGATGAAGTTGCGGTAGTCGCCGTCGATGCGTCCGAAGATGCGCGAGGACTCGACTGCCCTGGCCGGGTCGACCTCGCGAATAGCAGTG
AGGTGCTCGACGTTGCTCACGACGGTCCACCGGGACCCGTAGTCCGGCCGGGAGCCCATGGCCTCGTGCAGGTTgtactcggccagcgcgttctTCATGA
TgatctccacgcgctgctcgtaCACCTCAACCTCGGCCCGGGTGAGCTTCACCGGGGGAAAGTATCCATCGGGCAGCGGGAACTTGACATTGCTGGCGTT
CATGTTCGGAGTCGCACCGCTGCTCGCCATCAACTACGGGTAGGacggcagcacgcgcagacTAGTAGGTACAGTAAGTAGCGCTCAATGGAGGTgttcc
tgcgcgacgacgcgccTAGCACCAAACGTTCCTTTTGCAGTGTGTCGGCACGCAGATCACAGATCAATGCTCGTGCCGAGCGCTGTGCGCGATTGCGTTG
GCCCGTCCACCGTGTGCAATGCTGCAACACTGCAATGCCGTCGTCTACCCTGCAACTCGCGCTTGCCATGGCATGCGCCTTTCGCGGCCGGTCTCCTCTA
TGCGTTGCGCGGGGAAGCCCAGACATCCGGTTTCGTGGCGCCGGGGAAAGCGGCGGCGAGATTTGTGCGCGAAGGCACAAGCCTTGCAGTGCAAGTTGCA
GGGGCGACTTGGCCGATCGACTGGGGATCGGCTCTGCAGCCTTAGTCGCGCATGGAGTTCGGCGCCGGTCTTGGGAGTGACAGGATTCCGTCCAGAGAAC
TGGTTCTCCATCCACCACGCTCCGCATCGGCCGTGGCGGAAGTATCATCATGCGCAAGCCCGACGCTGGCTCCTACGCCGGCAAGAGCGAGAGGGCTTTG
TCAGCGTTAGCCATCCTCGGCGACCATGAGCCTCATGATGAGGGGAGGAAGACCGCTCGCGGGTAGTGCTCGTGCAACTAGTACAGTATCGCTAGACGCA
GCTACTGGTGCATTATATAAGGGCAGCACCCCTAGTAGGGGTGCTGCCGGACACCACAGAAGCACTCTACCCGTTCTACGACTTGGTGGTTCATTTTAtc
ggtgtgtgtgtgtgttaAATGCCTCCGCAGTTCACACGGCCACCATACGGCAAATTGGCCAtcgtggtcgtggtgctggcccagcacctGGTGGTGGGGC
ATCTCGGTGTTGCTGCCGCGGTCTCATTCATGTGCGAAGCCGGCCcctggcgctggcagaaGTGCCCCACGCGCACTCATCGACGGCTTGCCTTGACGGA
GCGCGGCAGGATTTGTCGCTTGCACCCCCTCAAGCCTTGAGTCAAGGCGCCCCGGGCCGCTGAGGAGTCGGCGACGCCATCCGAGCTGACAGTGCCGCAC
GCTGACTGCGGACGGCCCGCCCGGCGGGACTGAGCGAGTGCGTGCGCGACGCAAGTCCTGCCCTGCCCAACGatccctcctcttcgtcgtcagctTTGGT
GGCGCACATCTCGTTGtctggctgctgcggtcggTCTCCGATACTCGGCTTAAGCAAGTGTCCGTACATGTTCGTGCAGCTCATGGTGCACGTTGCCAGC
GCAGCGGAGACCCTCGTCAGTGACGACGTCACCTCCCCGCGCATTGCATCTTTTACGGGGGTGGCCGAGATTTCGTGGCGGTGCTTTGCCTCGGCCACAA
ACGCCGGCGCAACCACGGTCCACCCCGGACTGTATCACGACGCCGAATGCTAATTATTTTTTTGCTCTCGTGCATGGTCTTGTGGCACAAGTTGTGCGGA
GTAGCTCAGCCCTCTCTATACTTTCAACAAGCGGGGACCACGAAAAAAATGGCGCGTACCGGTAATCGAAGCCCCACGTGGAGTCTGTAACTTAGTGTTG
GTGACCAGCATGTTGATGGACGGATTGCAGGGTTTCGCGGTCTCCATTgcggatctcctcgatgATCCTCGGAACAAGGCGctgccgtgctggccaccaA
CCCACGGAACCGCTGGCGCGAGGCGGTCAGGCGAAGTATTCACTTGCTTTGTCGCTCGTAAATGCTCGCACGCACTGACCTCGCGTGACCTAGAGTGCTC
GGAGCCCGCGTTGGGCCATCCACTTCCGAGCGCGTTGCTCCGGCTACGCTCAAGCTAAGTCACGACACGCTGCCGCGACTTTTCTGAAGCACATCGCTGG
CAAATGCCCCCAGCTGGACCTACACGCATCCGTCTCTCGCTGTGAAGTGACCCCTGCAGCTCTCGGAACGGATCTTGCTACACCTCGGCCGCCATCGCCC
GGGATTAGTTTAGTTTTCGTTTTTCCACCATGCTGTCATCGAGGCGCGGCCGCACCGTGTCCCGGTAGGTTGGCCTGGCAGGAAAACCGCTGACTCACAA
GCCCCATGTAGCTGCCACGGGCTCCGATAAAACTAACCTCGCTGTCCACTTCAACAGGAACGACTCGAAGACATTCCCGCTGCCCGATGACTTCTTTCCG
GAAGtcaagctcacggacgagcagatccTCAAGTACGAGATGCAGGTCGAGAAAATCGTCCGAAACGCGCTGGTCGAGTacgagcgccacgaagcTAAAG
GGGCCTACCCGATCTACAGCGCGCCGTGGGGATCCGTCGGCAGTGAAGGCCCCCTGACCGCCATTCGGAAGGAGTCACCCGCGGGGCTCTCGCACAGCGA
GTTCCGCCTCTACGGCTGCATCCCGGGCAATTACCGCAATTTCATGGATTTCTACTACGCCGAGACGTCGCAGGAGCTCTTCGAGTGGAACCAGTTCATG
TACGGCTACGCGGTGGACGCGGTCGTGCTGAAGAACATCCACACGAGAGACTCGGGAAAGCCCCACGAGTACTTGGGGCTCAAGTGGACGTGTCTGCAGC
CGTCGACGTTTGGGCGCAAGCGCGACAACTGCTTTCTCGAATATCTGACCTACACCAAGGACGAGCTAGGCCGCAGTGTGGGCGTGCGTGTGACCCTGCC
ggtggagatcgacgagTGCCCGGACCTGTACCGCAGCCTGAGAGTGAAGCGCGTCCAGACGCACaacgtcgccatcgtccgCCCGGCAGGGGCATCTTCC
GATGCGACGCAGCTCTTTGTCATGAGCGAGAATGACTTCGCCGGGCTGTCCGTGAGTGCCAAGAACTTCAAGAAGTTCATGCGCATCTACAGCGACATGG
CCCTCTTCGTCGACTCCAAGCACATTCTGAAGGAGGGAATTATGTGcaagacgagctggatgcccAACGACTCGCGCAAGGCCTGCACGAGTTGCCAGCT
CCCGTTCAACGCTGCCACTCGCCGGCGCTCTCACTGCAGGCTTTGCGGAGACATCTTCTGCCACCACTGCCTGATTGTTCGCAACGTGCCGCGCGACCAA
CATGGCGCCCCCAAGTCGCGCATCTTCCAGGTTGTCAAATCTCGCTTCTGCAAAACGTGCCTTTCAAGCGTGCGTCGGGGAAGCGAAACAGCGCACACCA
CTCAGTGTGCGCTGACGCGGGGTTCGTCGGACACAAatgccagcagcgtcggcaccCTTAGCAACGGTGGCAACAACAAGCTACGCAAAGCGGTGAGCAA
TATCAGCAACCAGAGCAACTCGCGCCACGAGTGGTGGGATGACGTTGCGTCGGAGTCCGATTGGTCCGAGACGGACTCTGAGGACACCAGCAAGGCGTCG
CTAAACGCGTCAGGCCGATCGAGGCTTGCCAgctcgctgtcttcgtcgcaGTCGTCATGGACTACGACTCGCCCCGAAGACACCCTGGAAAAGGATGACA
TGGCGTTCGTGGCCACGCTGGATGTCATCGatgacgacgtggccatTCTCGATGAGAAGCCACAGAGTtccaagcccaagctgcACCATAAGCTTTCGAT
GTCCGGTCGGTACTCGATGAGTCGGAGGCACTCGACACgtaagcagcagcaccagccgTCCCAGGAGACGCACGAAGTCACTGAGGTGATCGACACCATG
GACATGATGCCAATGGCCGAGCTCCGGCGCCAGTCGCGGACAGGCACCGGCAGCATAGTGCTCCCCTCTCGAAAGTATAGCAAGCGACGCAGTGGACGGG
AGTCACTGCTTAGCTCGAGTGGCCCTACCCGACGCCTGAGCCGTGACGAGCCCACCAACCGGTTCCGTTCGTCCCGCTCGATCAGCCAGTGCCtcgcgga
gcaggaggaaTTGCTGCGATGCATGCTCAGCGTCAGCCGAGTGCACTCGAATCCTGGCGTCGGGTCCAAGAGGAGAGGgacgaagccgccgaaggTGGAC
CTTGCGGCGACGATGCCCATGCAGCGGCCCACCGTTCGGCTGTATGAGGTTTGAATCGATCGACAAGGCTCCAGCTTACAACAGGCGTATCTATTATTTA
GTGAATC