Description :
From Genome Similarity Track
Location :
Scaffold_276:32333- 37355
Transcript NameFunction/comments
Hyaar_Emoy2813445hypothetical protein
Hyaar_Emoy2813446hypothetical protein

Sequence
5022 bases(100 bases per row)
CATGAGGCGCGGCCACTGGATGCGATAGCGTCGCAGGAGTGAGAGCATGTAGAGTGATGGTCAAGTGAGTTGATGTGGACCACACGAAGGAGGTACCCAT
TTCGCCGCACTTTGAAAAAAAACACCCACAAAAAAAGCGAGCGGGGTAAGAAGCGTGGCTGGTACGTCTTTGTTTACTGTGCGCCAGTACAGTCTCTTGT
CCCGTATTGTTTACGTTTCGCGTTACTCTATTGATGTCATCACTATCCCGTGCTTCTTCTTGTTGACTCTTTTGACTGTACTGACTATAGAAGCTTCCAG
AGTGCCTCTTCCTTTCTCCCTTTTTGATATCTCTAAATAGGGTGAGTCTTGGAGAGACATGTCGGCCACTGACGTCGCGTCAGAGACAGGCTTTCAGGTT
CTGAGCACAGCAGACCGTCTGTTATTGCTCGTGACGATCGTGTTGTTCTTGTCACTGAGTGCCGTGTCGGGGCGCGTATTGTATCGACAGTACGTGGCCA
AGCGCAAACGTCTCAATAGTCTCACATCGCCGTCCCTAGATGAAGTTACGGGGGTCGCACCATCAAGTAAAGCCCCCTATTCTGCTGTCCCTCAAGCTCA
ATCAGCTCCAGTGAACGTCGTGGGTGGATGTGGGTCCGCTTTGATGGAAGAAGAGGGGGCAGCAGCAGCTTCGACAGGCTTTGAGATGCGTCAGAGACTC
TTTTTACTGCTGTTTGGGGCATCTTCATTACGTGTCTGTTCCATGGTCACGGAAGTGGCGACGCTCGAGATGGTCACGGATCTCCCGTCCACGTCAGTGT
ATTGTAAGCTCTTGGCGCTCTTCTTGTGGCTTCCGTCGATGCTGTTCGTGTCCATGTACGGACTTGTGCTACTCTTCTGGGCGCAGTTGTGCTACGCTTG
TCGGGGCAAGGCCCATCCGTGGCCCCGGCGGGTCTTTTTCTTGTTCAATGTGCTTTTGTATGCTGGTTTTGTGCTACTGCTGGTATTTGCGAGCACAGTG
GCCTGGTTTTGGAGAGGCTGCGACTTACTGCAAGGAGGCATCTTCTTTGTTGGACTGTTCGTGATCCTGTATTACAGTATCAGGCTTGTCGACTTTTTTC
GCAACCAAAGCCCAGACGATGATTTTTTCTTCGACTTATCGTCAGCAGCTATAGGTAGCAGTGATGCGACTGCTGGGCGTGAGCGAAGGTCGCCGTTTTC
CGTTAAGGCTATCTCTCCGCGACAATTGGTACTGCGAAGGGTAAGTTAGCTGGTACAATAGACCGTGCACGTGTTTGGTGGGCTGATGTGCTCTGTATTG
ATATGTGGTGTGGCTAGATCACGGCTGTGTGCATCTTGCTCTGTGTACTGTTTTTAGTAAAAGCGGTGTATTTGATTGGAATGGGCACTGGCTACATGGA
GTCGAAGGAGGCACAGTTTCGCGCTCCTGTGGGTGTCCGCCACATCGCCTTCGAGTTTATCATTCATATCTCCACCGAGTTTTTTCCCAGCGTACTACTG
CTGTACTTCACGCGTCAGGACAAACACGCGACGTCCCATCAACAACGTATTCGCTCGTCATCTGCCACCTCGGCATCCGCATCCTTATCCGGCGGTAGCT
GCGGTGCGAACAATGCATGCGAGAAGCCTTCAACGCCAAACTATGCGTACGCGCCCATTCGTGGGGTCGCTCCGAGTCACCCCCACCAAGAAGATGCCGT
TCTGATGCTTTCTGGGTACCAATATCAGGTACGCGAAAGTGAAAAGTTAGGTGTCGATTAAATTTGTTGAACCGAATTTTTGTGTCTTGTAGGCAACACA
ACGTGCATATGGAACAACTGGCAGCGCAACGACGAGCTCGCAGCTTCGCTCTAGCAATAGCAGTGGTGCCTTCCTCCTTGAAAGCATCAGCGGAAGTGCG
TTTGGTAGCGCAGGCCCTAACACGGGTGCAAACGCTCATTCGGCGTACCACAACAGTTGATTCAGCTCAACAACATGTTACGACTTAACATTTTGACGGT
CGATTGGTTTGTTCATGCTATGTATATACCTTGGAAGCGTTGACGATGCTCCTTTATCTGTGCTGGATATTGTGGTTGGAAAGATAACTTGACGTGTCAG
CGTTTTTTCGTTTTACGGTGCTAACAATGCTACTGGTCAGTGAACTTCAACAGATTCACAAGACGGATTTATACAAAGTTCGTAGATATACACTATTTTT
GCACCACGAAACTAGCGAGAGCAACAGTCTTGCCGACACTATAGTCTATCACAGGTACAAAATAATTGCTGTAATGCCTGGCCAGCAATTTGCCGATGAA
TCGAATCATCTTCACGCATTACCAATTCAATAGTTTTGAGTACACAAATTATGAATATATGAGGTTTCGTCATGTCTAGTGGTACAATTTGTCATCATAG
TGCCACAAACAAAACGGTCACCATTTGTATGATGAACGGTGGTATTGATGAGCTGCGCTGTTCACTAATACGACTAACTTTCGGTAAGTTTTTTTCTGTG
GTTCTGAAGCCACAGCCACAGACTCATAAACTAGACATACAACGCGGCCCGTCGAGTAACTGTGTGAGCAATTGAAACAGAGGCGAGAGGAGGGGTGTAC
ACTTTCTCGAGTGAAAGCCAATATCTGTACAAATATTGACTCTGCTCCAAATTTATGCAAGGTCACGAACTTATGCCACTAAGAGAAAGGCTTTCGGTCG
GGGTTACTTCGTACCGTGAATGTTGCTATTCCGAACTACAAACGTGTCAACTGTTTTAACGGGCTAGTATAAGCTATAAAATAAATAGTTCAATCCAAAT
TATACTTAAAAGAAGATGGTCGATAATTTGCTATCTTTAACGACTTCATCCAGTTTTGGGGCCTTTTTTACTACACTGTTTACGGTAGTTAGTGTGGCCT
ACACTAATTCCGAATCTCGCGATATTGAGGGAAAAACATAAATAACGTGGGCCACATCAAATGTGTAGGAACTCTAATTGGTTTAAGCAGGACCGACCAA
AAATCTTGTTCATTTTAAATTGAATGGGTACGGCGTCATGCCAACCCGGCAAGTGAACTCGATCCAAGAGCTCTTCCGCGTGCAAGCCCATCGACAAACA
GCATCGACTGAACCCTCCGTCGGCATTTTGGTTTCGACGATGACGACAACACTGTCCTGCAAGCTTCACCAGGTGCTGAGTTGACTGTAAGCGGTGAGTT
AGAGTTGACTGGAAAGCGGCGTCTACAGCAATTCAGTACTCTGTCTGACCGACACCGCATCGTTCAATGGATGATTGCCGATGCAGAACAGAATACGGAG
GCCAAGATTGCGTTGCGCATGATCCGCAATTTACCATATCAATTTCGAGGCGAAGAAAGGCGAACTTACTGAAGGCATCTCGTTGGTGGAAGGATAGAGA
CATGATCACCGCCAGTTTGTCGAATAAACGTCGCAAAAGTGGTACAACCAAGTCAATTAACAGCGTGTGTCGACGTGGACCTCGCCGTTGCTTGGAGAAG
AAGGCAATGGATGGTCGGGGTCGTAAACGCCAGCTTTGGGTCACCTGGCTTTATGCGGAATTGGTGGTCGAGTTTGACTGACTTCGCAAAGCTGGGTTGA
AGTTTAAATCAATAGTGTTGCAAATGGTGGCCAAAATAAGTCTGAGGACGTCACAAGGAGAATTTCATTTAGCCTTTCGTGATCTGCTCAATTGGATTAC
TCTCGACTTGCGCATCACACCAAGATGGATTCAGTCTTTTCAAGAGTATCACAACATCGTCATTCGTACCTAGACTGGCAAACTTATGACAAGCCCAGCC
ACTCAGCTCCAAATTGAAAAAGAATCTCATACCATCTTGGCCCAGTTGCGCGTGATTTTAAAAGTGGAAAAATGAATGAAGCTTTTGTTGAAAGTCTCGA
CGAAACTCATTTTATCGTCAACGTTGACAATGGTAAGACTCTGGGGTTTTGCGGCGACGAAAACGTGAAATGTGCTGATGTTGCCTCAGGTGATGTTGGA
ATAACTATGGTGGTTCAAATTCGTGGCGGGAAATTTGCAAGACTTGAGCCAGCGCTTATGATTTATCGAAACGAATCTCAAGATTATCTGATTCGTGGCA
TACCAGACGATGTCCCAGGTGTGGCCTATCGGACCGAACCCAAAGGATGGATGGACAAGCAAGTTTTGGTCCAGTATCTCAAAGAGCGTCGGGTAATCTA
CCCAGAGCGGTGGTCATCAGCGGGTGGTATTCATGGACAACTGTGGTGGACACAACGAGAGTCCAGAACAACAATCTGTGTTACAATGGCTCAACGCAGT
GATTCGGAAGCTCCCCAAGAATTCAACACATTTGTGCCAGCCTTGTGACTCATGGATTATACAAAAGATCAAGCAGGTGTGGACAGAGAGGTGGGAGTTG
GAAAAACCTCATTTGATTGAGCTCGGTGCTTGGCGCTCTAGCCCGAGATTGTCCGGCAAGGTGTCCAACTATGGCAAGTTCTTTTTTTTGAAACTGGCTG
CTGAATCCGTGCGTGCCGTGAATTCAATTAAGGACAAGAATGGCGTGTCGTATGCACGCAAGGCAATGATTCGATGCGGTCTTGGACTTGATCTGGATGG
CGAGTAGCAAGAGTATCAATTGTTCCCTGAGCTTCAGATAATTATCAACAACCATCGGGCACAATTTGACGGTACACCAGTACCAGAAGTGGTAGAAGAA
ATTGTTCAAGATAGGTCGTGATTCAGGTTACTTCAAATTTTAGGTTAGCCAAGGCTGAGATACAAAATGTATGAAAATATTTTTTCGTGCTTGTGTACTT
GAAGGTGTTTGCTTGTTCTAAGGAATGTCTAAACCACATCGTGCCTCATTATGGAATTACCCATGTACCTAACCTCAACCCTGGCACCACTTACTGCACG
ATGTTTAGGCGTGTCTAATGGTGTGGGCGCGCGGAGCGGTTTTTGGCGAAAGTATGAGTGACAACGCAACTTAGTTGCTCTTACGTGAAGACCTTCCTTT
TGATTAAAGCCTTTTTTATATC