Description :
From Genome Similarity Track
Location :
Scaffold_230:3233- 7194
Sequence
3961 bases(100 bases per row)
TGGCGATAACGTGGATGATGATGAACTTTCGGTGGATGATTGTCCTGATGGTACAAGTGGTGGTGGTGATGTTCCGCCACCTACCGAACATTCGGGTACA
GCTGATGACGAAGATGTTGAAGATTCTGACGGCAACTGGAGCGGCCTTGGTCCTGCTCGGCCTCCGACACCTCCTCGGCCAAACCCTTCGGCGATAGTGA
CTTCTCCGATCATAGTCGGTGGTCCGCCTCCTTCGTCATCGCCAAACCCACAAGCACCACCATTTTCGCCTCCTGCTCCGGCGTCTCCTCGCCCGTTCTT
TCGGACTCTCGATGCTGGACCTGGGCGCAAGATCACGGCCACCTACACTTTGGTGCCGCGTCGTGGCGGTGCACCGTCGGTTGAGCCGTTGCCTCACCGC
CTGTTGCCTGGTGCTCGCCCAACGGTGCCGGCCTCGTCCACCTTGCCACCGTGGGTTCTTCCGTACCTGGACATGGAGTTTGCCGGCATACGTGCCAAAA
AGTGTTTCGAACGACGCTTAAGCATGACCCTTCCAGAACCAGCCGGCGAAGTAGCCGTCCGTACGACGTTGGAAGGCCTCCAAGCGTACTTCGACTACTC
GAATCCCGATCATCCATACCAGCAACTCCGGCGGCTCTATTCTCTCCAGGCGTGTCTCTTCGGCACCATCGACTTCGATCCAAGTGTTCCCATCTCCAAG
CGTGCCCCAATTGAGACCCGCCTCAAGATGATCTGAGCGAATATTCGGACTGACGGCGGCAAGCAGGGTGACCTCGGGTTCGCGTTATGGGAACGTCTCC
ACTGGCTGATATCGAGGGAGGTCTCGTCGAGGAAGCCAAGAAGATCGCTCACGACAAGGAGCTTTTGAAGAAACTGAGAGCTCTGTTGAAGAAACCCTTC
AGTGAGCGCGACCGTCGGGCCGATCGTCTCCGTAACAAGTACCGTGAACAGTACATGGCGTGGAGTCGTGACTCGGTTTCCTCCGGTACTTCTGATACGC
CGTTTATTCCTCCTGAGTTGCTCTTGGAGCCGTCGAAGCCATGGTACCCGATCAAGAACTTGTCGTTCGCACCTCGGACATCTGACTGAATTTCCGAAGT
ACCGGCTATCGACGCTCGCCAGCCTCGGCGTACCGGATGGATGAACGCGCCGCACCAGCACCCGTACAACACTACGTACTTCCCGTGCCAATGTAATTTG
AAGCTCTTCAATCCTCGTGGTACGCGCTTTGTGGATGTGTACCGCAGCGTGGTCGTTGATCCGGCACTGGCTCCTCCTGAACTCATTCCGACCTGGCGAG
ACCTGTTTGACTCGCCATCGGTTACTCCACGTCCTGCGCTGGCTGCTGCTCCTGTTGAAGCGGGTGCCGAGGATTCGCAGGCTCCGGATACGGCTCCAGC
TGCCGAGGTTCAGCTTCCCGATGAAGAAGAGACAGAGAGTGAAGACTCAACTTCGTTGGCGCTCTTGGCCACCGCTGCCAGGCAATTAGAGTCACTTTGA
ATCCTCATTGCATGTTGCTCGACGTTCTCCGACATCCCAGCTAGCTGTTGAGGTGTCCAGCGAGGTTTTGTTTTCCGTGGTCGCTCCCCGGTCGGCATTC
ATGTTTTCTTATTCTTAATCCACTTTCACAGCGTAATCATGTTCATGTTGCTCTTCAAATGCATATACAACTTGTTGTTGCAGTAGCTTGTTTCGTCTGT
TACCACAGGCTGCATTGCCTTGTGGACAGTTCACACGTGATCCAGTCACGCTAGTCTTCGTCCGCCACATTCGCCATCTGCAGCCAATTCTTACTCTTCT
TGGCTCGCAAGTAGTCGTACAGCAGACCTCCACATGACAAGTTGGATGCTGGTTCCCAAGTTGGATCCTTATAGCCAGCCCACTTGACTTTGAACTCGCG
TACAGCACGCTACGTGCTCGTCGACGTGATGCTCTGTCGTCGAGGATGGCCTCGACTTCATACTCACCGGCAACTTGATCTGGTTCCCAGCTGTCTTCAG
GCAACAATTACTCGTCGAAATCGAGTCTTGCTTCATTAGTCGCGCCTAGTACCAACCGAGGCTTTGGTGGACTGCTGAATTCGTTGACTGCCTTGAGTCT
CGACACATGCACCACTGGGTAGACGCGGTATCCACTTCGGTCCGGCAGTTCCAGCTCGTACGCAAACTCTTCCACTTTGCGCTTGATCCAAAAAAGTCCA
TGCCACCGATGAGCTAATTTCATCATCAGGCCTGGTTTGACGCGTTCCATGTACAGCCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGGGCTC
TTGCAGGATCTTCCATCTCTTCTGAAGCTTTTAGGGGGTCCACCGAGTGTTCATTTCCACTTGGTTGAGGCACAGCAGCTTTTTCCAGTCGATTCAGGGC
ATCATTATGCTTTTTGTCCGTCGCTCCTTTTCTAAAGCCTGATAATTTTCGGCCATAGAGAGGGCGATATCGTGTTGTCGATTGATTTCGCGCCGCCACG
CCAGTGCGTCGGACTGCTTGCCGAATACTCGTTTGAGTAATGACGACATCGCCCGCAACGTCGACTGCGCATCACAACCGTGAACGAGGTAGAACGGTGT
TTCCTCCCTCGTAGTGTCCTGAGAAGTGTTAATAGCGAATACCAACTTCTCGGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGT
ACGAAGCCCATCACCGACTTCACCGAGCGTTCCTGATGTCAATTAGCCTGTGGTCGATAGCTCAAAGTTGCTCGTGATCTTGACTGCATCATGGCTGCAA
ACGCTTGGAAAGTCTCGCTCATGAAGCGTGGGTCGCGGTCGTGCCTGATCAATGATGGGGCTACGAGCCCTCGGTACACACATTCTTCGAACACTTGAAC
AACACTCAGCGCCGTTGTATCTGACATGGCCTTGGCAATAACGAATCTCGTGAACGAGCGCTGAAATAGGAGCAACGCTGTGTTGCCCTTGCGAGATTTC
GGTAGTTGGATCACAAAGTCCATCGAGATGATCTGAAACGGTCGTCCAGCTAGTACATTGCCAGGCGAGTATCCACGAAGCTGCGGACGGCTTTTACTCG
AGCTGCAATCCGGACATGACTTCACATGCTTCTCCACGTCAGTGTACAAGCCGATCCAATAATAATCGGACTTAACACGGTGGAACGTTCTTACCACTGT
GGTGTAGTGATTTCTCCGTAGTTGCGGATTATCACCCGTCGAAAAAGACGTGACACCGCCCAAGATGTTCAAGCGACGAACCCTCGGTCATGTGATGTAC
GGAGACGCCAAGGTGCAAGGGACTCGACGGCGTCACTTCCGAACTCTCAACGGATATTGGATACGGTCCATATGTCACTGAATCAGGGATGTCCTTATTA
TAAATGATGGACTGGCCGGATTCGCATTTAGCGGACCATATACGGTATGAACCCTCAGTGACGGTTGGGATGAGCTCCCGGAAGACTCAGCGACCTTTCG
GAAGCACGTTCACCGTCTGGGACAGGGCCCGGACCGTTAAAGATACTCATGCGACGGTGCAGACGACGCTTGGCATGCAAGAAGATCCATAACGGATCAT
TGTTCACTTGATATTTGTATACGTGATTATGTGGCGTAGCGGGATCAGCAAAATTTGCGAGATTGCTGGATCCAACTTACTAACTGCGCCCAGACACCGA
CGAACGGAGGGAGTCCCCCGATGATCCGTGTTCTGCAGAACTTTACTCGCCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTTCGA
AGAGTTCAAGTGGTGAAGGTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGTGTAGTTCCGTAT
CCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTT