Description :
From Genome Similarity Track
Location :
Scaffold_19:32320- 34052
Transcript NameFunction/comments
Physo_132052ABC transporter G family protein

Sequence
1732 bases(100 bases per row)
TTCTTCACCGCCTCCCCGTGTGGAACTTGTACAGCACGCAGGTGAAGAGAATCTCGAAGGCTACCGCATTAGCCGCCACGATCGCGAGGTCACGTCCGAG
ACCCGCGTCCTCCATGCCGAACTTGGTCAGCAACCGCTGCGCTTCGGCCGACGTGTCGTGCTGGAACTGGTTGTACAACAGCGCCTCGAAGCCGTAGGAC
AGGAAGCCGAGATAATGGCCCCAGATCCAGTAGTCCGGGATCGCTGGACGCGGCACGAAAAGCCCCATGCACAGGATGTACCAGCCGAAGAGAGCGGCGC
CAATCGCCATGCCGATGATAAAGTGCGACACACACGCGGCTACGAGGTGCATCAAGCTCTCGGCCACTACGAGCGACAGGAAGACGATCAGCAGGAACAT
GCCGTACGAGTTCAGGCCCGCCAGGTACCCCACGAGCAGCGTCGAGCTCAGCGCGATGAGGAAGATGCCAGGTAACGCACCCAAAAAGTTGGCGACGACG
TAGCTGAAGACGTTGAGGTTGCTGTTGGTGCGTTCGCGGAGGAAGACGGCGCGCTGCTCGATGAAGAAGGGCAGCACGGCGATGGACATGAAGACCAGGA
AGCAGTTGGCGTACGTCAAGAGGTACACGACGTCCCGAGGCTCGATGCGATCGTTGGTCGAGAGGAACATGGTCCCCATCATGAACGACAGCACCGTGTA
CATCACCAGTCGAACCCAGAAGATGCCCGGGTTGCGGATGTTGTCGAGCGTGTTGCGCTGCAGCAGTACAAGTAATTGGCGCAGTGGGGAGTTCGGCACG
CGCTCGATGGCTTTCATAGTGTGCGAGCCCGCTGCGTCCGCTTGAATGGCGTCTTGGATGCGCGTAGCTACTGAGCTGGCAGCGTATCCAGATACTAGAA
GGGGGATATCGCCGTGACCTTCGAAGTCCGTATTGGCGATGCTGATGAAGTGCTCCGCTGGGTCCTCGTGCTCGGGACAGACGTACCCCAACGACGCAAA
ATGGTGCAACATATCAACGCGAGGACCGAAGTAGACCGTCTGACCGGCAGTGAGGATCACGACGTTCGTGAACATGTCGTAGACCAGCGACGAAGGCTGG
TGGATGGTGCAGATGACCGTCATGTTCTCCTTACACAGTCTCGCCACGAACTTCATGACGTTGTAGGTCGACGCTGAGTCCAGACCCGACGTTGGTTCGT
CTAGCAACAAGATCGACGGCTCGGACAGCAGCTCAATGGCGATACTCAGTCTTCTCTTCTGGCCTCCCGAGATGCCCTTACGGAAGATGTCCCCGACCAA
TGTGTGCTCGCAGACTCGCAGCCCCATCTCGTCGATCACAGTCTGCACTCGCTCGACAACCTCGCGGTGGGTGACAGAGTTCGGTAGACTGAGCTTGGCC
GCCATCTCCAGCGTCTCCAACACGGTAAAAGACCCCAGTAGCGAGTCTTCTTGAGCCACGTAGCTCGACACGGCTCGGAACGTCTTGAGGTTTCGAGTCT
CGCCGTTGAGAGCGATGTCGCCTTGAAGTGTGCCCGAGCTGATGCGGTCCGCGAGGATGTCGAGCAGCGTCGTCTTGCCCGATCCGGACGGCCCCATGAC
GGCCGTGAGCTCACCGGGTGCACATCGACCCGTGACGTTGGTGAGGATGGTCTTCTTCCCGTCCGGGTGCTTTGGGGTCTTCTTCTTCGTGTCGACAGTG
TAGCACATGTTACTCCAGCTCAATGTGCACGG