Description :
From Genome Similarity Track
Location :
Scaffold_163:32316- 37319
Transcript NameFunction/comments
Physo_144037hypothetical protein

Sequence
5003 bases(100 bases per row)
GTGGGCAGTTTCGCTGGCTGCTTCGACTGGACTGCTCCGCTGTAAGTCACACGTAAGCTATTTTCGAGAATGGAAGCGGACAACGCACGTCAACTCGCAA
GAATTGCATGAATAACAAACAATCCTACATGGATGGAGAGGTGGCGACCACATTGAGGGGGTGGCCACCTAGCAGTACTCGAGCTTTCGGGTGATAGCTA
CAGCGTGATACGCTCCTGTTTCATATCAAAAATTCACAGTTAGCTTCAACCAGACAGCGAACGAACAAAAAAACATACACAACCGTACCACATGCGACTT
GTGAGAACTCGAACTCCCCCAGAACGCCGATCCTCTTGACCCGCGCATCGTCAACTTCTAAGGGGGCTCCGTTCCCTGCAGCCGGCGACCCCCATAGGAA
GAGGTGGCCCTGGTTCGTGCACACGGCCGACGTGAAGGTACCGCACGCAACGCTTCGGATGCCCGAATTGGTCGGCACGCGGATTCTCTGCGGCGTAAGC
ACGACCATCTCCGGTGCCGTGATGTATTCAACGCTCAGCTGTCCGGCAGCAGCGTCGCCCCAGCCATAGAGAGCTCCGTCACTCGTAGCCGCTAGCGTGT
GATAACTCCCACACGCAATCGCAGAGACCACCGACGTCTCGCTCGCTTGGTTCTCCTCTCCATCGATAGCATTCCCAGTCCACGGTCCTTCGATACGCCT
CGGTTCTAAACAGTTGTCGCGGTCGCCGTGACCCAGCGCTCCAGAGCTGCCGAACCCCCACGTCAACACGTCTCCTTCAGTGCTCAGAGCACACGAATGG
CACTCTCCAGCATCGATGGCCGCGATCCGGTAGTCTTCCAGCCCTTGCACTGCGAACGGCAGCTCCTCGTCCGTCTCGCTGCCATTGCCCAGACGCCCAC
CGAAGCCCGCGCCAAACGCAAACACTCGGCCTTTCCTCGTCAGCGCCAGCGTGTGCTCCCGTCCGCACGCTACCGCAGCGATGTTCTGTAGATCCGTCAC
GCGCGTCGGGTACAAACTGCTGCCGGTCTCACCAGTTCCAAGGCGACCCGCTTCGCCCCAACCGAAGCCGAACAGATCTCCACTCGCAGTCACCGCCATG
GTGTGTTCGCGGCCGCACGAGACCTCGACAACTCCACCAACGTCGACGCCCTCAGCTTCAATGAGACTGGTAAAATATCCCACAGATACCGGCTCCGTGC
AGTCTTCCTGGTTACCATGGCCCAGTCGACCGCACTCGCCGTGGCCGAACGTGTACAAGTGTCGGTCGTCAGTGATGAGGGCGGTGTGGCGATATCCACA
GGCGATTTGAACCACTCGACGCAAAGGACGAGGAAACGAGGCCATGCGGATTGGAGACGCGTTCTCGGCTGTTGGGCGCAGGCATAGCGTCGCAGAGCGG
CCCCCTTGGCTGATGTGGGCCTCTTCGTCCAGTGATAAGCCGAGTGGCTTGCCCCAGACCAAGGCGAGACCAGGAACGGGTCCTTCGTCCGCGGCGCCAG
CACGGACGCTCGTCATTCGACTGGAGATCTCTTCGTTGTTCACCAGTGCGTCTCCTGCGACGAGCAGCGAGTTATTCGCCAGCGGGGGGAGGAAGAAGCA
CTCGATGAACCACAGCGCATCTCCTCGTGACGAATACATGGATGGCAGCATTGAGGAGTCTTCGGGGTTGAAGCTGAAAGACGCTTGGTACTTTTCAGTC
CCAGACGCTGTCAAGTCCATTACAGACCCGTTCTCCCAGGTGCTTGTTGGACTTAGAGGGGCAGACGGCATACGCGAGGCGAACCCCATCTCACACAACA
CAGCTCTCGTGGCCGCGTCAGCCACTGGATCCCGCCTCATGGCCTCTATTCGGCGACAGTACGCGTCGACACTCAACATGACCGACATCCACGACTGGCG
AGACTGCTGACGCCTGAATCGCTCTCTCAAAGAGAATAGCAACGCGTTCTCCTGTGTCGGATCTTCCAGCTCCCTCTGCTCCGTTGAGAACTGAATGGAA
TACACGGGGTGAGACGACGAGCCCTTGGCAAACTGCGACGGGTTCGCTGGTCGGTAGAAGAACCTCAGCCACTCCAGCAGCTCGTCGCACTCCTCCATGG
CCTTGGCCAGTTCTTCGCCGGAGCTCACGAGCTCCAGACAGCGCAATGCCAGCTTGTACTCGATAGGAAACAGCGCTTTACTGGAGGCCATGCGCAGGTA
CGCGAAGCTGCAGTGCTCTCGAATGACAGCCGATACCTTGCTGTTCCCTGACGGGTGATACGAAGGAGCGGCTGCAGCACGAAGCGCCAAGCTCAGATGC
GCTCGAACCGCGGTCAAGTCTTGCCAGGACTGAATCGCCTTCTCCAGCCGTGTGAGGTGAGGACGGCTCAAACTCTGTCGGAAGATCTGCGACAGCATCC
GGTAGTACTGAGTCCACGTCGTCAATTCCGTCCACACGCCCAGCTTACCCTTGCTGTTGGTGTTGGTTTGCTCTCCGTCGTTTAAGACGGGTAATTCGGG
CTTCAAGGCTTCGAACTGTACGCGGAAGAACTGCAGGTTACTCCATAGCAGACCTTGGTGGATCTTCATGGCGAGCTTCGGGTCGTCTTCTTCGTAGTTA
AACGTCAGGTCGTCCTCGGTACGCAGGAAGGGGACAGACACGAAGCGGTTCTCGTGCAACTCGGGCAGAATCGACTTGGTCAGCCGCGCCTGGAAGACGT
GTAGTAAACTGTTGAATAACATGGCAGGGTTCACCTTCAACAGGTCGCGGTACTTGTCCAGGCAGGAGCTGGACGAGTTCACCACTTGGTTCTGAGTCTT
CGTATCCATCGCGAAACTGGATGAAAAGGCTCCTAGCGAGTACATGATGGGGCCGTCGATGTCCCAGAACTGGTCCCCGAAGCACTCCACTATCGCGCAT
CGCCCATCAGGGAGGTTCTTGTGGAAAAGACCGTGCATGATGGAGTCAATGAACTTGATCAGTCGTGATTTCCTCGACTTCCAGCGGCTTGTCTTCCCTG
TATCCTCGTTGAGCATGCGGTACCGGAACAAATTCTTCGCCAGTCGAGCCACAATTTCGCTAGCAACGAGAACTTGAACGCCCAGTTGGTCACGGCGGCT
TAGATACTGGAATACCAGTGGCAAGAAGCGCATGTTGACGCCGCCCTCTCGCATCGTCTGGCGGAGATGCAGCGTGTCAATAACGTACGTGCCGGAATTG
CTGTCCGGTAATCCACTTGCTCCTAGCGTTTGAGCCATGGAGCTCAGTGACGACATTCGTCGACGCAGAGGCGGCTGAGTAATCGGTTCAAACTCAGTGT
GTTGAGTAGCAGAAGTTGTTGATGACGAGAAGATATCTTCAGGTCGAGGCATAGACGACAGCGTGTTGGACCGGGTCAAGCGACCGCGAGATGGTGCTCC
TCCCTGAGACTGATTCCAAGTAGGCGCTCTCGGTCTTCCAGTTGCTCCAAACCCGGCTGTTCTAGCCTCGGGTGTGTCTCCAAGCGTGACGAGCTGCGCT
GCGAACTCCTTGATGTGTTGCACAAACAGCTTCTTCACTCCGTCTTCATACTCGTGGGCAACGTGCACACCTGTATCAACTGGACGGGATCGTCCATTTT
GGCTCCTGGCAAATGTCGGGCTTGAAGCAGCCAGCGCGAAGATGGCGCTGTTCTTCTTGACGCCCTGGAGCTTCCGAACAAGGGGGTGGATGTCCACGTC
GTGCTTCTTCACAAACGCCTCAGGCAGATCCAACAGCAACTTGCTCTTCTCTGCATCGACTGTGATGACAATGTCACCAGTCAGCGGCTGGCTTGTTGAG
TACCTGCTGGTCTTAAGCAGAAATTCCTTGGCAGCCAGGTTCTCGACAGGAGAGGCTCCGTTGCCCAGCTGGTAGTATACTAGATCCAGATACGGGATCC
AGTGAGGCTCCTTCGTCCGCACCAATTCCTTCACGTCAAGAGCAGAGAGCAGTTCAACCCGTTTGTTATCGTCACTCACCCCATGCACCGCTCGGATCAA
AACGCCGTGCACCATTGGCGATCGTAGCGAGTTCACAAGTACATTGTCGTAACGCGGGTGTACCCTCACCAGAGTTGGCGCCACATTACCAGGGAATTTC
CGTACTACCAGCTCAGGCAGTTCTTCGTATGGGAAGTACCGCAACATCTTGGCGTCACGGAGCGCCATGCTCAACCCGGCAAGGTCGCGGTTGTCAATTG
TCGCGATCGTCGAGCGTTCGCTCCTGAGGGGCTCAGCAATAGCGACGACGCTCACTCCACGAATCGAAAACGCCGAGACGAGCGGGAAGGACGGAAGCTT
TGTCAATACTGCACGCAGAGCCCCAGGCAGCTTCCCATCTTCGGTCGCACTTTCCGAGAGGAAGAGCTCAATCAGCGAGCGGAACCTGGCGAATAGTGCG
GTTTCTTTCGCTAGACGCTTGTGTCCCTGCCAACTTTTGGACGCAAACTCCAATCGGATTCCAGCGAGTTTCATCTCATCCACGTCGTCACGCTTCGTAT
AAGCGCTTCCCGCACTTTGGTCGTTGTCAATGCCCAAATTTGATGTCGTGGACGTAAGAGACGAAGTGGACATCGACGACACCAAGCTGGGGTGTGGCGC
TCCTGCACTCTGAGAAAACTCTGCTGCCCGTTGGTCGATCCCGCCGTTCAGGGCGAAGTCACTTGCTGCCCGTTCGAACAATTCGATGCGAGCGATTCCT
CGAGAATCTCGCTGCTGCACCGACGAGAAGAAAATCTCCGCCAGAATTTCCGTAAACAGCTCGAACTGCATCCAGATCTAATTTTTTTTGTTCGAAGGAA
ACAATGTTTAGACACAATTGACCCCCAACAACAAGATCGATCGATCCTACCGCACCGTATGCAGCCGCTTCAGTCGTCTCTGTCGAGCAGCGATCGGCTC
TCTATCATTCTTCAGTGATCTACCAGTGGCAACCAACCGCAACCGGATCAGCACACACTTTTCCCGACGAAACAACAGCGACCCACGGAATTTGTATCTA
AAT