Description :
From Genome Similarity Track
Location :
contig_38:323068- 324495
Transcript NameFunction/comments
g7119.t1conserved hypothetical protein

Sequence
1427 bases(100 bases per row)
TTCAGTCTACGTGGGTGAATGCGGACTACACGGTCAAGGTTGATGCTGCCACGACGCTTACAAGCTCGTGGGATGGATGGGGAACGTCGCTCTGTTGGTG
GGCCAACGTCTTCGGAGATCGCGACGACATTGCTGACCTACTTTTCACTTTAAAGGAGACGGTGACGTTGAACGGCTCGACTACCGGCCCTTCCGGCTTT
GGGACTCACCATCGCGCGCTACAACATCGGAGGATCTGCCAGTAACGTCGTTGACGACAGTGGCACGGAGGTCTCCATGCAGACTTCGGACCAAATGCCG
GCATTCAAGTTCATGGATACCTTTTGGCTGGATTGGATGAGCGATGACCCAACAAGCACGAGCTGGAGCTGGGACGCAGATGTGAAGCAGCGTACAATGG
TTGGCCTGGCCACTCAACGTGATGTCGACATTGTCGAAGCCTTCTCGAATTCGCCGCCGTGGTGGATGACGAACAACCATGCTACTGCAGGTGGAGACGA
TGGCGATAAGGACAACTTGTCCGATTGGAATCACGATCAGTTCGCACTGTACTTGGCCACTGTCGTTAGTCATGCCAAGACTAGCTGGGGCATTAACATT
ACCTATGTCGAGCCCTTCAATGAGCCCATGAGTACGTGGTGGGAATACCCAGGTGGTCAAGAAGGGTGTCACTTCGAAGTGGACACACAAAAGGACGTCT
TGGTTAGACTGCGAGCTCAGTTGGACACCCTTGGCCTGCAGGACGTAGCGATTTCCTCATCCGATGAAAATTCGCCGACGCAGACACTGTCCACACTCAC
CTCCATGTCGACGGACACAGATGTAATGGCTACCATAAAAAAAATTAACACTCATGGTTACGACGGCCAGAGCCCGTACCGAGGAGGGGACCGCGGCTCC
TTGAAAACGCTGGTGACCCAGTCGAATAAAAAGTTTTGGGACTCGGAATACGGCGAGGACGACGCGACCGGGCTAAGTCTGGCTGAGTCGATCGCACTCG
ACATCAATGAGATGGGTGTGTCGGCTTTTGTGTATTGGCAGGCACTGGACAGTGGAGCTTGGGGTCTTGTTCAATCCAACCCGGGCGATAGCTGGATTGG
CACGCCCAATCCAAAGTACTACGTGTTGACCCAGTACTCGCGACACATTCGACCCGGTATGGCTATCCTATCAACAGATGACACGAATACCGTCGTGGCT
TTTGACGCCGCGTCGAAGCTTCTTGTGGTCGTGACGGTGAACTCGGGCGACTCGGCATCTGCGGTCACTTTCGACTTGTCCAGCTTCACAACTGTGGGAG
GTCCGATCACTGCCTGGACGACGGAGACGAGCGGCACGGGCGCGCTGCACGAGTCTTCGAAGGTGGTTTTGTCAGGCACGTCATTCAGTGCGTCGATCCC
TGCTGCGTCGGTCATGACGTTCGAGGT