Description :
From Genome Similarity Track
Location :
Scaffold_12:32300- 39907
Transcript NameFunction/comments
Phyag_g367hypothetical protein PHYSODRAFT_478820
Phyag_g368hypothetical protein PHYSODRAFT_311081

Sequence
7607 bases(100 bases per row)
GTCTAACTCACTCGACACGACTGAATTctgtcgtgttggtgcttggaCGGTAAAACACGAACGAAAAGTCTGCGTGGAATGGGCCAGGATGGAAGACACC
GACGGACGAATACCCGAGTTGGTACTGCTCCGTTGAGTCGCCGAGGATCAACACGTCTGGAGCGgggaaaagctgcagtgcagaGTCAAAGTCCCAGTTG
ATCGGATTCGCCATCAACGGCAGCGGACACAAGTGTGCTTGGTCGATGAGTGTCTTGGCCAACTGAAAACAAATTCATCAACGGGAAACCAAAAGTCAGA
AATGATGTCAACGAGACAAATTTCAAGCTGCGCCGTACATGTTTGGAGATATCCGTCTGCGAGATTGACTGGACCGcatcgctgtcttcttccACAGCTA
ATTCTTGCTCGCTCGGCATCGGCGGCAGAATAGCATGCCGTTGCATCTTTTGCTGGAGATCATCACGGAAGATCACAATGTCTTGCGTGTAATAGCGGAT
CCGGCACGGGTTTGTGGTGCACATGACATTTGGCACCTTGCGGACGAGCTCACGAGTACACAGGTCTGGGAGCTGTTAGCAAATATGCGAAATAGTTTAG
CGTTAGCTTCGCGCAGGGCAATTAGCGGCAAAAACGTAAGGTTGGCAGTCTTACCGGGTGTCGTGGGAAAGCACGAGACGAACCTGGGTCGTTGGGCCCT
GGCACCAAAACGAAACGCGAGTTTTCAGCGATACCAGGGTACTTCAGAATGAGGTTTCCAAGCTCCTCTAAGTATTCGCGTAAGTCCTGCAGCGAGTTGg
atccagcacctccaccaatAGAAGCCGACATAAAATCACCCATGAGGATGAACAGCGTGGGCTGGACACTTTCGAGTCCCTGAAACAGCTCGTCCAACTT
GATCATGACTTGAGGGTCATCCAAATGCACGTCAGACAGCACAATGAATGCAGCGTGGTGGTCACTTGCTTCTAGCGCTCGGATCTGTTCGCGTTGCCGC
GCCGACACCTCCACACCTAGCGGATCGATGCCACCCAACACTTCCAACGACGCCTCCTTCGTCTCTGGCGGCGGGAAACCCATTGACTACAATGTAGCAG
CCCAGCGCACATTTTAGATGAAACCCCAAAACATCCCCAACGAGcacatttttttttacctGAACATGAAGGACATCATCGATTATTTCGCcttccacca
acaccacacaGTTGATAGTAAATAATCCGTCAGTGTAGGCAGCGTTTGTCAAGTCTATGATGATTCGCGACGTAAAGTCTTCCAGATAATATCTCTTGCG
TTCATCCTGACCCACCATGCCAATAACACGCCGCACTCCAGTCACACCCAGAAGCGACTCAATCCGCGACAACTAAAGGGCAACAATAAAAAGCAGTCAA
TCTTCACCAGCATcaaaattaaaaaaaaagaagCCCCATCTACCTCCATGTACTCTGTGGAATtagccaccgccgccgaaGGAGGTGCAAACAATCGATT
CCTTTTGACACGGAGATCCACCGACATGAACCGATTCCTCAGCAGCTGAATCCTCGACTCTGGTCCGGCGTGGAGTCGACGGTGGGCGTCTGCTCTCAAC
TCGAACGAGTTGTTGTGAGTGTTGAAATGGAGTCTCGGCATGTCAAAGGCACTGAACACTTGGATCTGCTCGTAGTCGTTTTCTGCTGAAACAGCTAAAA
GAGTGTCTAGTGCACTCTCTAAAGCCTCCAACGTCACCACAGACGTCGTCACTAAATAataacagcaacaacagctttAGTCAACTATAACAGTTTAAAG
CATTTTGAAGAAAGAAAACGCACTCTTGCTGCGGTCAATATTGTTCTTAACAGCGTAGAGAACATCATCCAGTTGCAGTGACGGCTCACTAtaagtggaa
gaagaagtaaTCAACATTATATTAGAAAAAAAGAGCATTGATGAAGTAGTCGCGTTCACGGAATTGTTTTGAAGCGACTACTGTGTATTTAGAGGTGCAA
AATGGATGGACAGGAGTGCAAGATGCATACGCACTTGGTTAGCTCATCGGTGAGGCGGCGGAGGGCGTCGGCGTGAAGTGCCAGCCCTTGTAACTTGCAT
GCACGCAAAACTCGCTTGGACGCCATAACGTTGACACTTTTCGCGCGTTTTTGGGAAACGGCGCCAAATGTATCCATGTTCATGTACCGATGTGTAGGTA
CTCAATTTTGAcaaagatggctacattttttCACAATCAATGTGcatgttgcagttgcagtgcgATGGTGTTATTCTCTATGTGCTCCTGCAGACTCTAC
ATACGCAGTAGAGGCATCCGTACATATATCCTGATCGCCAAAACTTGGAAGATTGGAACGATGGGTCGCCGGCCTAATAGGTTTGGTTGCCACCTTGACC
AAGTCCTAGCACGTAACTCATGCCCTGCGCGTCACGCACCGCAGACGAATCTCCCATCGCTGCCGACACGCGCGAAAAGGTGTTCCAACACTGTGCGCTT
TGTGGTCTCGCACTCAGCCTGAAGTTCGTATGTGGCAAAGCGATTTAGAATTTCCTTGCAAAAATTGTAACAGGAGGGATCCCTACCGTTCGTTGAGGAG
AAGCTTTGCAAGCCGCAGGTCGTCGCACTTGCTAGCACTGCATGACAATACATCTGCTTAGTGAAAGATCAATCGGAGATCAATACATGTACGGAGCTGC
ACGTACCATTCAAtgaggagctgctccaccacatcTTGGTCTACGTCAGTTCCGCCGAGAAATCCAAGCTTTCCACGCACAGGCAGCAGTGCTTGGGTGG
CGTCTTTAAAGCGCGCCTAAAACAATGATGATAGCATTGGTGAGAAAGCTCTCTTCTCGAATAGGCCAGGATTGGTGTCAAAACTAACCTCTGAATACGC
TTGAAACCCCTGGCAAACACTCTCATACACTTTCTCCAGTTCACCTACAATATCGATACAAGTTAGTCGTTTGAGTTTTCGTCGTGTAGAATTCCACGAT
TTCGAAATGAGCGCCAAACAGTTTACCTGGAATAGGTGGAAAGCTAAACTGGAACGGGGTAAGACCGAGTAGAGCCTCCAAGCTGCCAGTGTCGACATCA
GGTTCCGCAATCAACGGTTCTAGCGGAGGTGTAGCACCGGATGGGACGCACGACAAAATACTCTGCTCAAACAATGCAGTCGTCAGATAAAATGCCTGAT
GTTCATGTAACATcagcgcagcaacaggtACTTACGTATCGAAGCACCCTTGCAAGAGGATGGAGGCGGGCTGTAGACACTTCATTTGCATTTGTTCCTG
AAGACGGCAACACAGCAGACCAGTTGAGGAGGAGCTGTTCACCTAACTCTGTAGTATCCTGGCCTGCGAACCGCAGTCTCCAGTAGAGCTGGGTTGCATC
GCAAAGTGTGGGTACTGCATGGGGAGCACCGTCAGGCTGGTACGAGAGAATATTGACTTCCAACATCTTGTTGATGCGGTCGTAGTGGCCGAGATCCAGC
ATGTACAGTGCCCACTGGAAGTACAAATGGCGCTCTAACGGGCCGCCATTGTCAAAACCTGCCTTGAATTGGTTTGCGTAGCTCGCTCCGTGATTAGCGT
TGCCTCGCGCTTCGAGGACGTGTAGCATGGTATGTACTAGGACCATACACGTGTCAGTACTATGCAAAAAAAATTGCCCCAATGTGAGTGCACTTACATG
CCCAGCGATCGTTGCCGTTCATGGACAATGTCTTCTCCGCaagagcttctgcagcatctaGTCGTCCCGCAGCTTGCATTCCGTATGCTTGCATGCCCAG
CAAATGGCTATACCCAGTATCATTCGGCGACCAAGACGGCAACCGACgcgtcaccgtcgccaacATGTTCTTGTAGTCACTGCAACATAACAATCAGCAC
TTCCACACCAACAGCTCCTCCCACAAAACAACTCTCCCCATCTCACCCCAGAAACAGGTAGATATCATAACAGCAGCGCAACGCCAACAGGTCACTATGG
TCGTTCTGCAAGATCGTCTcgaacactgcagcagcctcatGATGACGACCGTGCACCATCGCATCCAGTGCCAATACGTGCATCTTCtcgcttgtcgtcg
tctctccTGCAAGTACACAATATTACAATTAGAAATTCATAAGCACAGCATTTCTAAAGCCTCCTCCTTACCGTCTTTGGCAAGTTTAGCGGCCACTTTG
AGTCtctcagcagcgtcgagagTGTCTTGGTGCATGAGCGGAGCGAGGCACTGGCTGGcgcccaccagcacgtggCCCATTAAAAACGGCGCATCGTCCG
CCaacacctgctgcagcatgaacTTGGGGTGCGAATTCATGCTCACGTACTGCCACACACAAGCTTCAGTTAGAAATGACTTTTTTTTTAACATTGCGAA
AATGACACgtacgtccagcagcgccaggtCGTAggcctgctgcttgctcgtgctgcggcTCAGCGACGTGTTGCGCGCGCCCTCGAACTCGCCGATGCCG
AAGATCGagcccagcagcgacatGGAGCGCGTCGAGCGCCCGCGCATCAGCGGCGCACCTCCGAGCCGCAGCATGCCGATCAAAAACGTAATTGTGGCCG
CACAATAATTAGACCAATTTTGTGTGTCATCTATTTTTTTTGTGAACAGCAAAACATCATGATCACGAAGTTTCCTAGGCCGATTTGATGACCGCTTTGA
TGCTCTATGGAGACGAATGAGGACCACTTGCTGCTCTATGGAGACGAATGAGGAGGTGCACTTCAACTAAAGTCGCCATGACGAACGGAAAATGCGTTTG
GATGCGAATGATCGTTTGCATTTCCACTTTATTTAATGACAGCATTGTGGCTTTCAATACGCTACGAACACGACACTAGTTCACAACTATCGACGCTTTC
TTTCGCGTCGCTCACTAAACACCGAAACCATCGGCCGAAATCCCCACTCACATCATGCTCATGTTGTTCCAGTTCTGGATGCCTGAATCGCCGCCCTGAG
GTTGGCTGGTGGGCGCAGCTCCAGTATTTGCTTCGGACGACatgttctccagcagatcgtcccacggagctgctgcctgACCCGCACCACTTCCGTGATA
CGCCTCACCGGCTCGTGGATAGCCTGCTGGTGCGAATCCGCttctctgctgctcgtcttcgtgtGCAGCGATTCCtggcagcatttgctgctgctgttgg
tgctgcaacaCGTTAGCGTATCCCATTCCTGACTTCTCTGCTTTGCCGTCCGAGTACGGCGAGAAGCTCGAAGGACGCAAAAATGGCTCGGGTTGATACT
GTTGCgcgggctgctgctgctgctgctgctggctgtaaTCAAACGAGGTCGCTGATGATGCAGGCGGAGAAAGTCGCCCATATTGTGGGTACTGAGATTG
GTCCATCGGCGGAGGCTGAAGGCCGAAGCGGTTTACTTCCACGTGTGCCTCGGGCGTGcgcatcttcttcacaggGCGTTGCTCgggctgctgcaacagc
gctGGAATAGACGGTCCACTTTCGTGCATGGAGGACGAATATACTGTCGCCGCGCCAGAGCTCCACGATGCAGTCactgcactgctgtcggcCGATGTTG
ACGCCAAAAGGGGCGGCATGGGGGTCACGCTGGCCGAGTTCGCTGGGGACGGATGGTGATTCCACGATAACAGCTCGTTAAATTGTCCGTTGCGCAAGAG
CTGCATGGCGCGCTTGCGTTTCTTGGCATCGGAGACGTCGAGGCCCATTACTGGCTGGCCGATCAGCACCGCGAACTTCAGAAAGTTGCTCACCCagaac
tgctgcaccgctAGACACAGATTTTGCGTTTCCACGAGAGCACCTTCGTCCGTGTTGTTTTCACGTCGGAACTGGTCCACTAGCTCCTGTCGGAAGATTT
GTTCCAGTCGCGACAACTCGCGTTGCCTGCGTGCGTGGTCCATTTGGTCGAATTGCAGCGCTTTCTCGCCCTTGCCTGGTTTAGTCACGCGAAAAGTCCG
CTTTCCCAGCGCATTCTTCTGGAACTTCTTGGACAACCTCATGGTCGAGCAGTTGAGCATCTTGGCCAACACCAGTCGGATGGGGGTGCCGTGTGCCAGC
GGCAAAGCCTGTCGGTCGAACTCGCAGAGAATGCCGTCGATGAATTTCTCCTCAGGACGAGTCCACTTCCCGCTGCGGGGCTCGGGTCGGACCATCATGT
TGATAGTCGGGGAGATGGCTACCTGGTCGAGGGGCGCCACGCAGGCCGGACAAGCGTCAAGCGGCCACACGTGGACACACCGCGAGTGGAAGATGTGATT
ACAATTAGGAGCTACGAGAACAGGGTCGGGGTACTGACAGACATCGCACATGCGTTCCATGGGCATGGCAGGCTCCGCGCGGGCCTCCGGTGTGGCCTGC
ATGCGGTAGtctgactgctgctggtaggCCGCAATGGGCTTGTGCTCCATCGGGGACTCGGCGTACGGGAACTGGGAGATGGCGACAGGCGTACGACTCG
GCTGATAGTATGTCTGCTGTTGCGGCGTGTATTGCTGCGGTAGTGGCGAGGGCTGGTAGTAGACGGGGGCCTCGAGTGTCGGGCGCATGCTCGGCACTGC
GGGGCGATCGCCCTGCTGGCTGTACTGGTTACTGTAATCGTAGTCGTATTCTTTgggctgctgttggtgccCGCCACTTGGCTGCATTCTCGAATTCTTG
AAGACCGACTCAAAGACTGGAGCTCGACCTTCACAAATCATGCGTCGTGGGGGGACGGGTGAGCTTGCAGCACTTTAGGCTGGCTGTTTGTTGGCTGGTT
GGATAACGAACTCAATGGTCCGCCGAGCTACTCGTTTGTCCCAGCGGCGAGGACTGAGCAGTAATGGATGAATTCGAGAGTGAGGCTCAAGTAGGAGGGG
GAGGAGCCCAAGCGAGCGGTGGCTGGCTCAATTCGGCAGTGGCAGTATCAGGCGACACAGTGCGAGGAACGAAAAGGTCCAAGAGGAACTCCTCGTTTTT
GTGTGTCTCGACTCCTTTCCCCTTACTGGCGTTGGCGCGCGGCAGTGGAGTTTCCTCTGCTCGCGGGGTTAAGGAGAAGCCGCACAATCGTGTTCGCAGG
CGAAGGCGATTTGCTGATGCCGCCCGGTTGTATTTgcaccaacgacgacgaccctCGCGAAACGAGAAAAGCTTTTGTGTTGGTGTGTCCACCtcgttgg
cgttgttgctgttgccgtgACCCGGTGCTGGCCCGTCCCACTACACACGGCTGTTTGGCGACTCGCAAAGTTGGCTGTCCTCGCGGAATCGCTTGTGTGG
GTCACGTCGAGCTGACTCAAAGCTGAGACTTGCGCCCGCGTGGGACTGCGAGGCCGAGGTCGGTGAGACGCACGCTACGCTGGATAAGCCGGTGGTGTTG
GCACCTGCAGAATTCCAGCTCCTCAGTGCAGGTCGCGGGCATCGAATGCAGTTCCTACCTTCGGCCTTCTGTGTAGCTGACTGCAACCAACTGGGTAGCA
GACGGTCGGACGCCCCGATCTCAATCGGTGGGACGGAAAAGGACCGGCGGCGCCTCGAGAGCAAGCGCAGGATAGGACCGCGGCGCCGGCCACCTGCTGG
CAAGCAC