Description :
From Genome Similarity Track
Location :
scaffold_1512:323- 1396
Sequence
1073 bases(100 bases per row)
TCCGAGAACTCCAGGGCTTGGTTCACCTTGCACCTCACCAAAGTATAGAGCGAACGTCTGCTTCCATTGCTCCACCTTGGTGCGATCTTCCATAAATTCC
GGAAAAGCAGCCATGTTAGCTTCCAGAATTTCTCAAGGCTTGTTTGTGTTAATGTCTGTGCGTGGACTGTTGGACACCAACGACGTCTGTACCTCCTCGG
AAATGATCCAATTCTGAATTGGCAATTCATGAACAACTTTGCGGCAGCAGGGTGCTTGGCCTTTGAGAGGATGCCCACACGCTGACCCCAGCTGAGGTAC
TCAGTGCCATTGGTTACAAATGTGGTTGAGTTACCGCGCACACTGGAACCAATACCAATGGCCTTCTCCCCAGTACTGACTAGATCACGGGCAACGTTCG
TGCCACGGTTGAAGCTGACGTTCTGCTGGGCCAATTGGGATATCCAGTCCCAACCATATTTCTCGACGTAGCGAGTATACAGGAACAACACTGCGTCATC
GTCGTGTGGGTAGGACGAGGCGATCTTGCCAGCGTACTCGGGCTTCACTAGATCTGCAGGAGTGGTAGGTGGCGTCAGGCCATAGAGTGCAGTCGTGTTG
TAGATGAAGCTGAACTGGTAGATGGAGTACCCCAGCCATGTGCTGTTTTCGTCTTTCAGTGAATTGTGGATCTTGGAAAAGTTGGCAGGTTTGTAAGGGG
TGAGGACTCCATTCTTAGGAAGTCTTGCAATGTCTGCAATGCCACAACGTCGGGTACTAATGTGTCAGTTTCCAACTGGTTGTCGATACGGACGTCGTGG
TACTTGCTGTAGTAGTAAAACTAAGTTTTGGAAAGCGCTTCTCAATGGCAGCGTGAAGGGTGTCCTGCGAGGTAGATGTGTCTCCACCATGATAGAGGAC
GAGGTTGCCTCCTTCAGACACAGCATAAGCGTAGAGCTCGTCAATGGTTTTGGTCTCCTCACCGGTCTCAGACTTCGCTACAGCGCCGGAGGTGAGCAGA
ACAAAAACTGCCAGGAGTGAAGCGAAGATCTGCATTGCTACGAATTGTCGAGGCTTTTGTTGAGGCTTCACGG