Description :
From Genome Similarity Track
Location :
Scaffold_19:322987- 324312
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007624Similar to Ttc28: Tetratricopeptide repeat protein 28 (Mus musculus)

Sequence
1325 bases(100 bases per row)
ACCAGACGGTCGCGCAGAAAGAACGCATCTACGATCTTCTGAGCGCGCTCGCGACGTGCTACTCGCGCCATAGCGACTTCAGCTCGGCGCATTCAGTGAT
CCTCGACACGATCAAGCAGCTCGCAGAGTGTCCAAGTCGTCGCGACGCCGAGCCGCATTTGTATTTAAACGCCGGGCGCGTGTGCCACACACTCGGCAAG
TTTGGAAACGCCGAGTTGTACCTGATCAAAGCGGAAAGCGGTGCAATGAAGCTGAACCAGACTAGCATCGCACTCACGTCGCTGCAATGGCTGAGCAAAG
CGAGCAAGCAGCTAGGCAAAGAAGAGTCGGCCGTGAAAGTGATCGACAAGGCTCTTGCACTCGCTGAAAAAGACGCGAGCCATGCTGACATGCTGGATCA
GCTGCTCTTGGCAAAGTTGGATCTGCTGGACCCTGAGGCGAACCCCAAGTTCAAGCTCATTGAGTACGACAGCGAAGCTTCACTATGGAAAGCGCTCGAC
TACTTTGAGAAGAAGATGCACGCGCGTGGCCACTTACGTGCCTCCGAGGTGCTAGTGCACACCCTCAAGAGCTTGGAGCAAGATGATGTGGTGCTCAACA
AACTTGAGCGCGTGCTGTTCGTAGTGGATCGCATCAACATTGGCAACCTGACAGCTTCCAAGGACGATGCGGCCGTGCTGATGAAACTGGTGCTCTGCAA
AGTGGACTTCCTCATCACCAAGTGCCAGAAGCGGAAGGCGCAGACGCTGCTCGTCAAGACGCTCTCGAGTTTGCCCAAAACAAAAGACGCGCACACACAG
CGACTTCGTGGCTCGGCGCTGAAACGACTCGCAGAGATCGTGGACGAGACCCTGGAGGTCGATGCGCTCGATGGGCTACACCAGCACTTGAGCGACGCGC
TTGTGTTCCTGCGCAACGACAAGGAGGCTGCGTCGAGTGCGCTGGTGCTCAGTGGGCTCTTGACCAAACTGGCGCATACGGAAGCGAAACGCGGCGAGAT
CCTCAAGGCGCAAGCGTTATTGGAGGAGAGCGTGTCGCTTGCGCGCCGCATGAAGGACACCGACACGGATCAGGAACGGCTCTGCGGCGCGCTGATCGGA
TTGTGCGTGCTGCAAATGAAACAGCAGAACATGGGCAAAGCGCAAACGATCATCGAGGAGATCGACAGTCTGCCGTGCGCCGAGATGTGGAAGGAGATGT
ACGTGATCAAGGACCAATTGCGTCTGGCGAAAGAGCAGGAAGAGCAGCAGAAGCGCGCCGTGGAGGACCGGAAACGCCACGAGGAGCTGCAAGTGCTGCT
GCGTCAGAACAGCCTCGCCGGCTGG