Description :
From Genome Similarity Track
Location :
Scaffold_46:322834- 333604
Transcript NameFunction/comments
Physo_136526hypothetical protein
Physo_136527hypothetical protein
Physo_136528SR protein factor
Physo_1365292,3-bisphosphoglycerate-independent phosphoglycerate mutase, putative
Physo_136530hypothetical protein
Physo_136531hypothetical protein

Sequence
10770 bases(100 bases per row)
CGCGCAATTTGGCCACGCCGCTTGAGAGGATTACTCAGAGTGTCTTGTGTTGCCGTCAAGTACACGTGCAATATGTGGCTTGCGAGAAGGTTGACATCGT
TATCAGGATCAACGGCGACACCCTGGCAATAGGCCAGGAAGCTGCTAAGCGCAATCACGGCAGCTTCGATGCGCAGGAGCTCGAGAGATGATTCGCGACT
GTGAAGCACACTGGATTTGAGCCACAGGTTCAGGAGCTTCTCCAAGTTGGCCTTTATCCACAGTTCGTCGTTCATAGCCACGAGACTTCCCACCAGCGTC
CAACCAGCGCGTGTGCAGGTGAGCCAAATGCTGTCCGCACACTCACTGAGGAACTGACTTTCAACGAGCTCCTCGGAAATGGAATAGATGTCGTCCATGA
TCGCTTGGGACAAACCTCCCTTGTCGTCAAGCTTTATGGCTCGGAGAATATGGGCAATAGCAGCGGATCTGCCCTGAATCGCGTACAAATGGGTCTTGCT
TTGCATATCATTGCCGTCATCTTGGCCATCGTCAGTCTTCTCAGTAGGTTCTGGATTTCTCGCTTCTTCGACATCAGAGCCTCCGCGCATCAGATACTCG
GCGGTATCCCGTAGGCCCTGAAGGCAGCTGGTCAGCACGCTCTTGAGTCGGTATGGAATTGCAGTGACAAGCGAAGCCAGAGCAACAGCAGCCTGGAATC
GAACACTCTGCTTCTCGTGACAAACCAGCTCTTGGAATATGTCGCTGGCACCGCGCGCATGACTCACAGAGGCTTCCCCCATGGAGTGGAAGAGGTGACT
CAGTTCCACCAATGCTGTCAAAATCTTGTGGTGGTTCGGATCCGCTGCCTGCGCCTCATCTTTTAGTTTCTGCAAGTAGGCGCCCAGCAGAACCTCCTGT
TGACGCTCTGTGAGGCATCCGTTCAATCCATAGCGCAGCACAAAGCCCACAGCGTTGCGCGCTCGAGTCAGATCTCCAAGAGCGAAAGGGTGGTCCAAGA
TAGCAAGTATCGCATCCAGGACTTCACGAAGTTGCGACTCAGCGATCGAGTCGGGCGGCAGACGCTCGAACATGCTGCACAGCGCGATGGAGAACGAAGC
AAGAATGCCTCCATGGATCTGATTCGGGTTGCTGGACAGATACTTGCTGGTCACCATGTCCTTGAAGTAGAGAACCACATTTGCGATGGTCGAGAAATTC
ACTGTGGCCGCTTTTCGACGAGAAAGCGCCGGTAGGTTTAGCCCCGTCATTCCAGGAACGTGCAGTTTGAATCCCGTCTTGGACTTCCCGCTACCACTGG
ATGGAGGCGTGTCGTGTTCACTTGAAGATCGTCCACCGGCATCCTCCTCATTTCTAGAAGATGCTGCACCCGCCCCATTGCTCTCACCCTGCTGCATCTC
GCTCTCCCCCGACGACGACGTGGCGTATTTCGCGAGCACCGTACCAACCACCACCGAGTACGCCCTCCTGGCTTCGGGAGCGACGTCGTCCATTCCCTTG
GCTGTAATCTGCAGAATGGCATCCAGAGAAACACCCTGCGCGCTCGCGTGGCTGCCTCCAGCGCCCGCTCCAGCAGCTGACCCACTGCCACTGGCACCAG
CTCCTCCACTTCCACTGCCATTGCCACTCCCGCCTCCTTGACTTCCTCCCGATCCAGCCCCCGAACCTGCTGACGCCGCCGTCGACGCCAAAGTCCGCTC
TGTCACCACCTGCAGCAGCCTCGCCGCAGCGATGCGCACCTCGGGCGCCTTGTCCTGGAAGCTCTTGTTGACGATCTTGAGCGCCTCCGCGTGGAACGGC
ACGAGTCTCCTCGAGTCCCCCTCCAGCGCGTGGGCCACGCTCTCAATAAGGCACTGCTTCATATAGTAGTCCGCCGCGCGGAGGTTCTTGTTGGCCAGCG
CCACGGCGTCGGGCAGGAACTGCAACGCCTCCTGCTGCGGCAGGCGACACACCACCATGACCAGCGACACCTTGACGTAGAGCGACATGTTCTTGGCCGC
CAGCGTCTCGTTGATGCTGGGCACGACCGAGAAGTCGAAGGAGCGCACCAGCAGGTCGCACACCAGGCGGTGCACGCACTCGGACGTGGTGACGCTGGGC
GTGGACAGCGACACGCCCATGGCGCCCGCGCCGCTGCCCGCCGCGCCCGCGCTCGAGTTGCCCGTGTGGCCGCCGCTGTACACGATGAGCGTGGCCAGCA
GCAGCTGGAACAGCGCCGCGTTGGTCTTGGCGCCGCGCTTCTTGGTCGGACTGGGCGTCGCCAGCAGCTCGGGCTTCCACAGCCGCTGCAGCGCGATCAG
CGCCTGCACCAGCTCCTGATGCTGCTTCTGCTGCTCCGCGGCGGAGCCTCCGCCGTTGCGCAGGGCCTCCACCGCGGCCGCCAGCCGCCGCGCCGCGCCC
TTCATCTCAGCTGCGTCGCCTACTGGGGTTTCAGTATCTGACGCGTGTGGGGGAATAGCGTCCCCGGGGGTATAATTCGGGCGAGGGGTGGGAGGGGTAT
ACAAAAGTCAAGGTATTCCGCCAAGAAGACCAAGATGATGCAGACGACGACGCGGTCGTGGGAGGACCTGCGCAGCAGCGCGCGCGCCGCGGAGCGCACG
CTCGAGGACAAGATCGCGGCGTACACGGCCATCAGCAGAGCGCAGGTGCGCAGCTCCGCGGCGGCGTACGACGAAGGTGCGAGGAGAAGGAAGAGGAGAG
GACTTGAAGACGCGCACTGTTGCTGACTTGTCCTTTGACGCTGTAGAGAACCCGCCCGAGGAGACTGTGGACGAGAGGGAGCTCGCAGTGGATATTGAGA
ATGTGCTGGCGTCGGTGGGTGCAATGAAGCTGCTTGTGGAGGACGGAGGAAGACAGGATCGTTGACGTGTTGACTCAAATGTGTTCTGTGCGATTAGCTG
TCGGACACTATTGATGAGATGAATGTGGTGGTGAACAAGACGTCGGTGAAGACGCAGGATGCTATGCTGCAGCGCTACCGTGAGCTGTATTTCGACTTCA
ACACAGAGTTCCGTCGCTCAATGGTAGGACTGCTATTGCAAACTGTGTTTCTGTTGATGGCATAGGTTTTCCGAAGCTTTTATTGATGTCGGTCGGAATT
TATGTGAACGCTTGTGTTGTGCTGAATAGAGCGCATTGCAGGAGAAGCGTGACGCGCAGAAGCTGTTTGGCAACAGGTTCGCTTGCGTATCTTGACATGC
AGTGCTCCGTTGTGTTCATTATACGGCTCCACACCAGCGTTCTAACCGTTTCGTGTGTTATTATGACGCGCCTTCAATTGATTGAATAGAGGACACAACG
GCCACTCGGACGACGCTGAGATGGATTCGTTGCTGAACGAGCGCCGCGCCGTCGACTCGTCTCGCTCCATGACGGGCAGCATTATCGAGCAAGCGATGGC
GACCAAGAACGCGCTGGAGAACCAGCGCCGGCAGTTCACGTCCTCTCACGGCAAGGTGGCGACGCTGGGCAGCTCGTTCGCCGGCATCAACACGCTCGTG
GAGCAGATCCGCCGCAAGAAGATGCGCAACAACACCATTCTCGCGCTGGTGATCGCCGGCTGCATCTGCTTCACGCTCTGGTGGGTCGTGCTGTCCAAAA
TCTAATGTTATAATCGTTATAGCAGCCACTCTAAGTGTAATGCACAGCACGAAGTTTCTAGTGACGTCTTCATGCAACGCTGCAACTTGCAGTGCAGTAC
AAGTGTTGCACACGTCACATTTTGCACTAAATTGATATCTACCAATCAGCACCAGCCACCTCTCGATACCCATCGCCCATTGGTCATAACAGCATCCGCG
ATTTGCCTGCTAAAATGGTTGGCGTCCTTGGGGCTTCATACTGAAAACGACCGAGCCAAGAGGCAGAGCAACCACTATGAGCATGGGCGACCGCGGAGGA
ATCTCGCTGCTGGTGCGCAACATCAGCCGCCGCCTGAGGTGCGTGCGCACGCCCACTACTCAGTCCATGGCATGGAGGCTCTGCGCCCGCTTGAATGGGC
CCCATGCGCAATGATGTGGACAATTGACTAACCACTTTGTGTCGGGTCTGCAGACCCGAGGACATCCGCAAGGAGTTCGAGCGCTACGGCGAGGTGCGCG
ACGTGTACATCCCCAAGGACTACTACACCAAGTACGTTGGCAGAATTGAGCATTGCAGGGAGAGAAGCTTGGGATGTTGGGGCTGACAGCGAGACGCGTT
TCTATTGTTGACAGGGAGCCCAAGGGCTTTGCGTTCGTCGAGTTCCGCAGCGAGCGGGAAGCCGACGACGCCCGCCGCAACTTGGACGGAGTGCGCATTG
ATGGCCGCGACATCCGCGTGGTGTTCGCCCAGGAGCGTCGCAAATCGACGGACCAAATGCGCGAGCGCGAAAGGTACGCGCCTAATTCTTGCAATGAGTT
CTGCCACGAGGTTATGAGGCTCAATTGGTTGATGTATGTATTGGTCGGATGCTAAATTATAGGACGGAGAGACGTGGAGGAGGCCGTCGCTCACGCTCGA
GATCGCCTCGCCGCCGTGCGCCGCGTGGCCGATCTCGTTCTCGCTCTCGTGACCGTCGGGCCCCGGCTCGTCGCTCGTCGCGCTCGCGCTCTCCTGTGAA
GGGCCGATCCCGCTCTCGTTCGCGCTCGGGCTCGCGCGGCCGTTCGCCTCCGCGTCGGTCGGGCTCCCCGGCACCGCGCTCGCGTTCGCCGTCGCCTCGC
AGGTCGGCATCCCCCCGCGCTGCGGCGTCTCCTCGTCGCCCTGCGTCTCCTCGCCGATCGGCATCGCCCGCTGCTCGGTCGCCTTCGCCGCGCCGCACGA
AGGACCGCTCGTACTCGCCGTCGCCTCGACGAGATGAAGGCCGCCGCTCGCCTTCCGGTTCCCCGCGTCGGGATTAGGCTGATGCGGTCGCATAATGGAT
TGGTGTCGGCGGATAGCTAGCTGCGCTCAAACCCCTGTCTCAAATCAAGTATCGCCGACGGACCAAGCGAGCGACATGGCCAACTACGTGGAAAACTGCA
CGACATCTCGCGTTGATCTCATCCATCCTGTCTGCTTCCCACTCGCGTGCGATTGTTTGCTGGTGCGTGTCCGTCTACCCGAATGGTATACAGGCGCTCA
GAGCAGAAGAAGTCTGAAGATGGGGAAGACTCAAGCAAAGATACAAAACGCAAATAAAAACAAAGAAGACTGGGTACTACAACTACTTGTCCAAGAGGAA
GGAAAGAAGAGGAAGAGTGTAAAGCAAGCTGCGACCCCAGCCAGATGAGCCTCGTAGCGTCGGCCGGGTGTCAAAGGTGGTCCGTCTACTGTTGAGCCGT
GCGTGTCCTGTTCCAGTGTTGTGGCCCTGATCAAGCGATGAGGCACCCTGTAAGGTAAGCACGGAGTGTCCGTCTACCGGTCGTTCGTCTTCCGTGCATC
AGTCACTGTTGAGTGATTGATAAGCTGGCGGTGGACGCAGGAGGACGTGACCACCATGAAATCTGGAACATTACAAATTCTAATTTGTAATTTGTAAGCT
CCAATCTGGGCAATACTAAATCAGATCTATACGTCCTAAATCCGATTTTGGATACGTGTTTCACCATCGCCCAAGCTCCGCTCACAATTACCGAGGGGAA
GCGTACGTCAGCAGCTCATGAAGAAGAGATCCGTGGTGTTCGTGCTCATCGACGGGCTGGCAGACGTGTCCCTGCAAGAGCTGGACAAGCAGACACCGCT
GGAGGCGGCGCACACGCCTACCATGGACGCCATCGCCCGTACGATTGTCGGTCTTTGATCCCTTCCGGCCCCTTGTTTCATTCATCATTTAACACTCTCT
CGCTGTGTGTGTCCATTGCCAATTAGACGGCGGCCTGACGGGCCTCATGGACCCCGTGGAGCCTGGCTACGCGTGCGGTAGCGACACCGCTCACATGTCG
ATTCTGGGCTACAACCCCTTCGTGTACGTGGGGGGGGCCTGCAGAGCAAGCTGCACTGGGATGTGAAACTCACGCCAACCTTTCGTGTTCCCAATTGCAG
ACACTACCGCGGTCGTGGCTCTTTCGAAGCTATGGGCGCTGGGCTGCCTATGAGCAAGGGCGACGTCGCGTTCAAGTGCAACTTCGCAACGGTGCAGAAG
AATGAAGACGGCCAGCTGATCGTGGAGAGGCGTCGCGTCGACCGCAATTTCCCTGCGTGGGGCATCGAACTCTGCAGCTTCTTGGACGGTCTCACGCTTC
CGGAGTTTCCGGGTCTGGTGGTGGTGACGAAGTACGCAACGGAACACCGCTGCGGCATTGTCTTCAAGGGACCAGGACTGTGCGATAAAATGACGGGCAC
GGATCCGCTGAAAGACCAGTACGTACACGCCCTGCTCAGACAATATTTTGCGGTCGGGTTCTAACGTTTTGTGCGGTTGTATCGACATGCAGTTTGCCGC
TGGTGACGTCGGAGCCACTGAATGACACGCCTGAAGCTGCGTACTCGAGCAAGGTGTTGAATGCGGTCTCTAATGCGATCCACGAGCGCCTGTCGGATCA
CCCGATCAACAAGGCGCGTGAAGCAGAGAACAAACCTCCGGCGAATGTGGTACTGCTGCGCGGTCCTGGTGAACGAATTGACGTACCAACGTTCACGGAA
ATGCATGGGCTCACACCGTTCATGATCGCCCCGACGTGCATTATCGCTGGTCTCGGAATGTCTCTGGGTTTCGAGATCGCTACGGCCCCTGGAGCAACTG
GGGACTACCACACCAACTTGCGCTCGAAGGCCGAGACTGCGCTCAAGCTGCTTCATGGCGGCGATTTCGACTTTGGATTTGTTCACGTCAAGGCGGTAGA
CGACGCTGGCCACGACCGTGATGTCGCCAAGAAGGTGCACTTTACGGAACGCGCGGACGAGATGATCTCTGTTCTACTGGAGGGAATCCACGCTGAGTGC
GGTGACGAAGCCAATGAGGTGACGATCGTTGTCACGGGTGACCACACCACGCCTGTCAAGTATGGCGACCATACATTTGAGCCGGTGCCGTTTGCGATTG
CGCGTGCCGGAACCGCGTACAAGAGGTTGCAGCACATCAAGAACGCTGCCAACCGAGCCGATGTCAACACTTCGTCACCTGGCCCACTGACGGACGAGGT
CACCCGCTTCTCTGAGATAGCAGTGGCGCGTGGCGCCCTTGGTCGGTTTGCTGGTGACCAGGTCATGACGCTCGTGAAGAGCTTCCGTGAGTATGAAGTG
TAGACTGCGAATGTGCAAGAAGCGCGGCTATGAGAGTAAGTAAACAAAATGGTTGTTGAACTCATGTTACGATACGCCTGTGGTATTGCTCAGCTTAGCA
GCATGTACTTAGCTGAACATTTTGGCCGTCATACGAGATATCAACCCCAGGATATCCTCGATCTCAGTGTCGGTGAAGTGCTTCGGGAGGCTTGGAATCA
GCGCAACGGCCTCTTCCGCTCCCTCCGGATTCAGATTCGAGAGGCACGCGATCTCAAACTCCTCGAGCCTGTGAACTTCCTCGCCGTGCTCAAATGAGAT
TGTCTGCAGAGCTCTACAGTTGAATACACCACCCAGCATATCGATAAGCCACGGAACCAAATAGCAGGATATCGATGCAACATAACGCACTCGCGGAGCT
CGATGACAGAGGCTTGGTTGGCCACAGGGTCCCTTGTTCCGGTGAATCGCTGCACGTACGACTCTGTCTTCTTGAACGCACTGCGATGCAGTCGATTATC
CGGAATGAGAACAGTTCAGTCTTGCAGGAGTTTTCACACTATGAGACTAAGGTGGTCAAACCTGGTGAACGTTTTCTTCTGCTCCAAGTAGTTGACCTTT
TGCTTCTCCAGAATGATAGCCACCTCGGCGTTGGATAGACAAACATTATCTTCGAAGTCTTCACCCAGGTTCAGCTCTGCTGCGTCTTTTGTCTCTATTA
ATGGCCGAGAAGTGAACGCCATCCTGTCGATTTGGCGCCTTGCTTTCGTGTTCACCTCCTTCCTAACTGTCGGTTTGGTTGACACTCGCCAGTTCGTTGG
CACCGTCCCAAGCCAGTCATGACTTCAATTCAACGGGGCAATCCGCCTACTGTTCCGATAGTTGACGGCTATTGTGCTGTAGCTGCTGAAAATTTCTCGG
TACTTCCAGTTCACGTGGAATAGGTTGCTTGGCTGCAACTAGCACTTGCTTCAACTCCATAGCGATTGCACACTCGCGCGTCAGGAACGAGGTAGCTTTC
CCTGAAACATCAGCGCCGCCAGTATCTCCTCCAGGATGTCGTCCTGTGCGACCACAACGGTGCACATAATCTTCAATAGTGCGGGGCATGTCGAACAGCA
CGACGTGCTCGATATCAGGTAGATCGAGTCCTCTCGACGCCAAGTCTGTAGCGACCAAAACGTCAACGTAACCAGCTCGGAAGGCGCGCAACGCCTGTGT
GCGGTAGCCTTGTGATTGACCACCATGCAGCGGTGCCACGTGAAATTGCTCACTCCGAAGAAGGCGAGCCACACGCTCGACACTAGAACGAGAGTTGCAA
AACACAAGTACTGGCGGCTGCTTAGTGGCTCGCAGAACCCGAAGCAGGCGAGATGGTTTCTCCGCGGGACGCATGAACTGCACATCATGAGACACGTTGG
ACGTTCTTGAAAGTGCCAATATAGCCGCTCGAGTACTATCGGCAGCTTGGGCGGAAGACGACATCCATGCGGACGGAGCTCGGCTCGGCATGTTCGCTTC
ATCCACTCTAATTGTCACAGGCCGAAGCACAGCCGACCTCGCCAGCCGTGGCAAGAAGGCAGGTAGTGTAGCAGAGAGCAGTAATGTTTGCCGGCCAGCC
GTATTCGCAAGTTGCAGAATCTCGCGTAACTGGGCTTCCATCTCGGGGGCTTCCAGTACGCGGTCCACCTCATCAACTACGAGGAGTGAAATCTGGCCGA
GATACAGCGATTCTTGATGTCGCTGCATTAAATGCAGTAGTCGTCCCGGTGTCGCCACGACTGTCAAGGCCATGTTGCTGTGTTGCTGTAGTTGTACGAG
TTGCTCATCTACCGCCACGCCGCCACAGATTCCAACGACAGGTGGGCTGGATGAACTTGGGAAGAATGCAGATAGATCTTGGACCACCTGATCCACGAGC
TCTCGCGTCGGTACGACAACCAACGCACACAGTGAGACCGGCATCATTGGCACCAGCGGGTACTGTGCAACTTCATTCTGCCGTTGCAGCAGCCCAAGCA
CCGGGAGGATGTAGCAAAAGGTCTTCCCGCTGCCTGTAGGCGCCAGAGCGATCACATCACGACCCTGCAGGATACACGGGAGTGCCTGAGCCTGGACAGC
GGAAGGTGTTGTCACTCCGCGGGACTGCAGCACCTGAATGGCGTCCAACGACAGCGAGATCTCCGAAAAACTGTGGATTGGAGGCGGAATTGGGTCTTCT
CCTTCGACTGCGATTCCTCGCTCTTGACGCGCCCAGGACGCTTCTTGCCTCGCTGAGTCTTCAAACGTTAAAGAGGCAATAGGTGCATCGGTTTGGACGT
CTGTCGAAGATGCAGTGGGCTCTGCACGCCGACGCTTACGCCGCGGCACATACGCTCGATCCGCCATGGCCAGCAATGGTTCGATGCAAAGTTACAGTAT
CTGCGACGTGTGAGACATCAGTTATGTTCGAAATCATGTCGATTAACGTTATCAGGTTGCATAGCGTTAAAATGACGCCACGACGACCTGAGCAGCCTTA
GCCGAACATGCGCGCCGCCGTACGCGACACAATGCCCAGAATCTCCTCGATCTCATCCTCAGCGAAGCGCTTGTGCAGACTGGGGATCAGTGCCACGGCT
TCCTCCACCTCCTCCGGGTTCAGGTTGGACAAACACGCGATCTCGAACTCCTCCAGACGGTACTCGACCGTCTCTCCGTCCTCCTCACGCTGGAACGCCA
GCGACATCAGCGCCCTGTATCACACGACAAACACGGGTATTGTTAGACACTATACAGCAGCCACCTAGACATAAAGCCACGTACTCGCGGAGCTCCGTCA
CCGAAGCTTGGTTGGCCACGGGGTCCTTGGTGCCGCTGAAGCGCTGCACGTACGAGTACGTCTTCTGGAACACACTGCAATATCACATATAACGAAATGC
AGCAGATTACAGAGTGGTTAGCTTAGACATAGCAATGCACCGACGAGGAAGCGCAGGACAATGACACAGTGGATGGAACGGGGGACGCACTTGGTGAGCT
GCTTCTCCTGCGTCTCGTAGTCGGACTTCTGCTTCTCCAGGATGACGGCCACCTCGGCGTTGGACAGACACGTCTCGTTGCGGAAGTCGTCGCCCAGGTT
GAGCTCCGCCGCGTCCTCGGTGTCCACCACGTGCTGCGGGTTGGCCGACATCTCTATCTATCTACCCGAAGTATTTAATAAAATAAAAACAAAAGTGTTC
GTATCAACCGCACACCACATTTACACCAACCCCCTTCTCGTCATACCATTCCGTTCATCAGGTCGTGAACTTCCATCCACACTTTTCCGATCTCCACCAT
GTTGAGCAGCTCCAAGGCGCAGCTCCGGACGCTCGTGGCCGCGTCGCAGCGCGCGTACTCGGCCAAAGTGGGCGCGGGCGGCATCGCCGGCCCCAAGATC
ACGGGCGTGCTGCGCTTCTACAAGGACGTGGGCGTCAAGGACGTGGAGGAGCCGGCGGCGGAGGACGGCGCCGAGCCGCGCATGCTCTTCGCCGTGACGC
TGGACGGCAAGACGGTCAAGACGCCGAGGCAGCAGCCCGTGCGGCTGCCCACGCGCGCCATGGCGTACGC