Description :
From Genome Similarity Track
Location :
Scaffold_1357:3228- 10747
Transcript NameFunction/comments
Phyta_totarag12790reverse transcriptase
Phyta_totarag12791hypothetical protein

Sequence
7519 bases(100 bases per row)
TCGTGCAACGGCATGGCCTGGAACCGGTTATGTCCAGTGCGCTGCCGTAGGAAATCGTACAGCAGTCCTCCACAATTGAGATCCAGCTCATCGAACCCAT
GTCGTATTGGGACTCACTTCAAATTCACGTCGCGTCCGACCATATCGGGGGCCCCATCCCTCTCGCATGTCCCGTATCTGCTCGACCTCGAAAACGTCAT
CTCCCAACTGCTCAGCTTCCCAGCTATCCTCCGGGAGgagttcttcgtcaaaaTCGAATCGTGTGTCGGCAGCTACCGTTAGTCGCGCGTCGGGAAATTC
CGGACGGCGTTCAGCTTGGAGATATGTACAATcgggtacaactggtacgACGTGCCGTTCGTCTCGAGACGCGCGGTGTATGTGTTCACCATCTCAGCGA
CTCTGAACGGGCTGTGTCACATGTGTGCCCGCTTGCGAGCGTACCCCGGTTTCACGCGATCCAAGTAGAGCCACACTTGTCAGCCGGCTTCGATCGGGTG
TTCCGTTGCGACCTCGTTCTGGAGTCGGGCCCTCGCGTTGACTGCGTCTTGGACTAACTCTAACGCTGGTGCTCGCGCGATCTTGTAGTGCCGCTGGATG
CGTAGTCTCcagcgcttggcctccacgTCGCGATACGACGTATTACCGGCGGCCAGGGCCGCTTCCAGCGTAGATCGCGGGTCCTAACTGTGCACGAGAT
AAAACGGGTCTCGTTTCTCGTACGATCGTGTGCCGTGTTGAGCGCGAAGGTAAGCTCTCCGTGTATTCATCCCAGTCTCGCTGATCGACGTCCGCGATGT
GCATCTTAATGGCTCTCGTGATCGTTTGCACCAtgcgtcctgcagcaccgtTGGCTTGGTGCCTGTACGCGAGCGTGGCTCGCTGCCTCTGACCCATGCG
TTTGCTGAATGCCTTGAAAAAGTCGGACATGAAGCCCAGCTCACGGTCGTGTCTGatcgcttcgctcgcgcCGAATCGTCTGAAGACGGTCTCTTCGTAT
GCTTCCGCAACTGTCTGCGCGGTCCGTGACGCATTCGCCTTTACGATAATGAAGCATGTAAACAGGTCGACCCACACGAGCAACTCGGTGTTGCCCTTGT
AAGACACTGGCAACGACGGGATGTGGTCCATGGCCATGACTTGGAACGGATACGTCGCCATGATATTGCCTGGTGACTCGCCTTGGATCGTCGGTCTCCC
CTTTCTGGTTTCGCAGTCCGTGCACTCGCCCACAAAACGTTGCACGCTCCTGAAAATCCCTGCCAGTGGAAGTGGCGTCGTAGTGGCTGATACGTCCGGC
CGATTCCTTGATGGCCGCCTTCCAGACTCGCGTGGTAGTGCCTCGCGGAGCGTCTCTGGGaccaccagcttcatgaTCGTGTCGCGTTCTTCAGCCGACT
CATCTCCCCTCACATGGTAACACAGTAAgccgccttcaccttcttcataTTGGTAGaccatcttgctgcagttcttcgcCTCCCGCCTGGAGAGCTCTCC
GATATCGCCGTTCAAATACTTCTTGAGATTCGTGATCCAcagctcttcatcttggGCGATTCGGATGCGATCTAGCCTGAGTCGCTGTACGACCAGCTCC
TGAAGGACTTCTGGTGTCTTAGCTGGGGTCGACGGGGtccatgctgcagcagaccgGGTGGTTACTGCTTGCGCTTGTGCCACCAAGGGTTTCGCGTCGG
CGCGATCTACCGTCGACTGGTGTAAATCGGGCGTTTCTGGATCGGCTCTTCTTGATCGGACGATCTCTCCGAAACGATCAGATTTTGGATTTCCTCCGGG
CTTCGGACCTCTATGCCGCCTTGACGTTGCAACGCCTGTCCAGCCAGCATATCGACGCTCGCGTTCCAATCTCGGCGTACGTGGAAGAAGTCGTGACGGG
GCCATTCTCGTAGCGCGTTCCGGACTCGCTGCCGGAGCAGCTTCAGGCCTGGTGACTTGAAGTCCATCTCCTCTCGCACCTGTCGGATGGCGAGGTTTGA
GTCTCCGCAGACGATCAGCCTCGAGACGTTCAACCCTTCGAGGAGCGAACATCCGAGCAGCATACCTTGGTATTCCACCTCGTTGACCGTAAGATCTACC
GCGTATCCTGACGCAGCACGGAAGACTTCCCAGCCTGGTAGCTTCCAGATGATCGCGCTAAACGCTCCACATTCTCGCTTGGCGTTGGCAGATCCGTCAA
GGCTCATCACGTGGAGCTCTCCATCAGGTGTGCTCGTCGGGATTGGGATGACGGCAATTCGCGACGGACGCTTGCGCGGTGCGATCTCTTCCAGGACGGT
ATCCACGAAGGCTCTGGGTGTAATGCTCACAGCTAACGCCCCAAGTATCTCTTCTCCTCCTTTCGTGGACCGGTGAAATCTCTAGCGTACATGGTGAGAG
TATGGCGGCCCATTGCGACAGTCGACCTTGTAGCCCTTTGGATCAGAACAACCACGCCAATGTCGTGTGGCAGGTCAAGCCGCGTATTGATTTCCCAGCC
AGCATCGTGAATCAGTTGTTGAGGATGCGCAGCAAGGCCAGggtctccttctcgacgatgTTATAGTTCAACTCGCTAGGCTTCAACGTGCGACTGATAA
ATTTCACCGGCAAGTACACGCCGTCGTGAGCGTGTGTGAGGGCTGCCGAGATCGCCCAGTCGCTGGTGTACACGATTACGACGAGCTCTCGGGTTGAGTT
GTAATGCTTCAACATCGGAGTCTCGGCAAACTTGGCCTTGAGGGTCTCGGATGCACGTGACCCATGCCTTCACTTCTCTTGTTCGCGGATTTCCGGTTTT
GCGGCGAATTCGTCGAAGTCGGTCTCTGTGAGCGAGTACAACGTGGTCGTGTTGATCGCGAAGTCGGCGATGAACCGGGGGGTAGTAGTTTAGACTGCCC
AAGAAAGTCTGCAAACCTTTGACTGTACGCGGGAATTCCAAGCTCGTGAGCGACTCCAGGTTCTTAGGCTTTGCTTCCAACCCGTGCTCCGACACCTTGT
GACCCAGGTAGTTAACCTGAGACATTCCTCACGTGCTCTTCTCCACACTGATGGACAAGTGCCATTGATCGCAGACGTCCAGCAGGCGTTCCACTTTCTC
GCACAAGTCATCCCATGACGTACCACCGATCAAGATATCATCGACGTACGATCGACGGCCTAGAACGGAGTGGATCCCCGGAAGTTCCGGGTTTCCTCCA
TCGAAGACGCTCCGTGTATCCCGATCTGGGATCAAGCTCCAGAAGCCATAGAGCGCATTGTCGATCAGTCGCTGGTATATTTGCGGCGTGTTGTACAGTC
CGAACGGCATCTGCTGCCATTCGAACAACCCAAACGGGGTGATGAACGCCGAGGTTAGTCGGGTCTGATCTGTAATGGGGACTACCTAGAATCCGCTGGC
CATGTCGAGGGAGTAATACCACAGGTACTTGTCCAAGTCTTCCAGCAAGGCATTGACGAGCGGCATCGGATACACCATCAGCTGCGTCAGCCCGTTTACC
AGTCTGTAGTCGGTGCAGAGACGGATATCGACcccgttcttcttcataATCGTGACGATGGGCGATGCCCACGGAGAAGTCGACAAACGGGACATGCCCG
CGTTGAGGAGCCCTTTGAGCAGGTCGGAgatcttctccttgaactgAGGTGAGAGCTTACGGACGCGTTGCGCCATCGGCTTAGCGTCGCCAACGTCGAT
GTGACAGACGGCCCTTGTTACTGCTGGCGGTAATGCATTGCCCTTCCCGATCAGCCATTTTCGCCGCTTCCAAATGATCTTGCGCATCCGGTCTATTCTT
CCTGCGCAGCCACCAACGATGTGACCCAGTTGGTATTCCGATTTTGAGATCTTCGATCTTCACTTCTGCGTTCAGAGAGAGTTCTGACAGAACAGCCATT
TCCCCTTCCAATTCTTCTGCGAAGAGGTCTGATCCTTCGTGGAAGAGTACAGCGTCGTCCGCGTCAATGTCCTTGTCTGGCCCATCCTCCGCTGTATCCA
CTGGCACCTGATTCAGAGGATGCATTTCTTCCACTTTCTCCCGTTGTCCCACGATGTCGCACTTCTGCGGCTCTCGCGCTGACTCTTCGCATTCAGACGT
ACGTGTCGGTTCTGCCGCCGTCAATCGCACAGCCGCCACAATCGCAGCGACCGTTGGGGGCGACTTCCGCTGGCGTTCCACTGGGTCTTCCATCTTCCTT
TCGCCTCGACGCGTGATTCCTCTGGGGATTTCGTGTGTCGGGCGCTCGGTCATCAGTCCGTCGGGTGTCCAGTCTTCGTCCGCATCGCAGGTGGATCGGT
ACGTGTGGTTCTGCCACTCTTGATAGCGTCGCGACTCCACTTGCACGAAGCCGAAGGCGCGCGGAATGGCGTCTACGGGAGTCCACCAGCCCAGCGGCGT
GTGGGCGTCGAGCCTTATTGGCTTGTTGCCGATATTGGTCACCCGCAGGTATATTCGCCGCCCGATCTTGCTCTGCACGAAGGTGCTCACCCATGTTTTT
CCTCGTGTAACCCATAGTCGCGGAGCGTTCCAGTCTGGTCGCAGGTGAACGTCGTGCGTTCGCCCCGggtcgatcttcttgagcgacgTCAGCGTGATCG
AGTGCATCTTCGAACCGTACAGCGGTCTTCGTCCGATCATCTGGATCCGCACCTCGTCGAGCAAGCACACCGTGCCGTCCGCGGTATCGATGTGCAGTCC
GGCTGGCGCCATGAAGTTCATGCCCAAGATCGCATGTTGGCCCACCAGGTCTCCGACCCAAATAACCAGGAAGTAGACCAAGTTCCCCGCTAAGGTGATT
TTAATCCGTGTCTTCCCCACCGTGTAGTATGTTTCGTCGCGGATTCCCACGCAATTCTGCGTTACGTCCGTTTCGATCAGGCAGCCTACCTAAAGAGCAA
AGGTGGTGTCCAGTATGGACACCTCGGCGCCTGtatcgagcagcaacgtaGCACGACGGTTGTTCAACTCCCGAACATCTTGGCCTGCCGATACCATTTA
TCCGGCGCGTAGTACTTCCAGTATCCGCGTCGTTCTCTAGGCTGCAGGTCGATCACGTCTAGCGGCGGCTCTCGCGCGTACTCGTCCGGGCGTCGGGTGT
CCAAGACTCGGGGAACGTGTTCTTGCGAGACATGTTTCAGGTTGAATTCACATGTATTATGTATCGAGGTATTCGAGACTTCACTAACCACCTCTTGCGA
CTTCTTGGTCACATATGCATAGACTGAAACAGGTGGCTCGTCTCGATCTGGTTTCCAAGCCAGCCAGTGATCACGTTTGACATCTTTCGGCCGCCAGTGG
CAGCATTCCAGCATGCTTCTGCCGGTCATACCACTGGCAAAGCTGGATGAAGAATTCCTCCATGGGACATTTTTCGGCTTCGTGCACGTCTCCACGCGTG
TGGGCATCGGTCCGTCGGGTGATGGCCACCGCACTTCTGACAGGTCAATAAGCTCCAGCAGTCTCCATCAGAGTGACGATACGACTTGCAGTGGCGGTAT
CGCGGCTTGTCTCGCCCCGAGTCATCCGCGTCAACATTACGTCGTGCGTTCTTGTCCGGCGTCACTTGGCCCATCACAAACAGCTTGGCTcgttcttcgt
cgcctcgatcttgattgTACATCTGATCGTCGCTGCCGCGGTCGTCGCGCCCCGAGTCGTATCAGTCCAATGCGACTTGGATCGCGTGAACCGCGCGTGT
CGGCGGTATCGGTGTCAACGCCTTCTGGCGGAACTTGGTAGATCCAACCAAGGTCTTCTTCTGGTAGATGAGTCACGCTGCCGAGCGCGTAGCTATTTCT
CCAGCGTAACGATATCTGACACTTCCACCAAGGTGCGTCGAGAGGCCAGTTCTTGTTCTTATGAACCGAGGGTGTTGATAAATAACTCCACGTGTTCTCG
TTTCTCCTCTTCTGTGCCATCAGCGTAGTGGATCTTGGCCCGCATTCCCGTGGCATTGAGTCGGTACAGGTACCCCAACGGAGTCTCGTTGGGATGCTTG
GTGGCATGGTAATACCGACTCGCCATAGACACGGCTTTACAACAGTACTGGATGCGCAACTGCTCCGTCAGATCCGTCCATGACTTCTTGACATTTCTac
ccagctgcaggaacCATTGGCGCGCGGGTCCGGTCATCAGGTCACCGAACAAGGCGCACACTTCGTCACGGCGCGACTCGGACTTCACGCGGTTGATCCA
GGTCCGGGCCTTCTCTTCGCTGGAGTCCCGACCGTGGAACTCCTTCAATTCAGAGAACGCAGACTGGTGTACGCGGGCGACAGCGACCCCAGCGGTGccg
gccgtcgtggccgagATAGTGGCTGCATTCCGGGCGTGCCGGTTTCCAGGTCGAACAGATCGTCCGGGTCCTCGTCTCGGTTGCGTCGAGTACGCGGCGG
TCGCGACGTGGAGTGTGAACTCATCAACTCCatggccacgtcggcgtctGCCTGCTTGCGCGTCACCGTCGGTTCTGGATGTGCATGGGGTGTCTCGGTG
ATGGCAGCCCGCATCATCGTCGACTGCATCAATCAGACGATGGCGTCTCCCAGTGCCTGGGGAATGGCTTCCTCCTTGGCAACTGGCGGCTCTGCACGGG
GCGGTGCTGCATGACGTGGAGTGGTCTACCTTCTGGCATAGACATCCGCTTGGGCgactcgacgctgctgtcaGAGTTCACGCTCTGCGGGTTCAAGAGA
AGCCGTGGCGTCACCGATGTTGACTCCGTGTTGGCGCGAGGTGGGGCGGCCTTACTCCTGGCCGTCCCGACCAGAACGGTCAGGGGATTAGGGATAACCA
TGGTCGCACGCTTCCAAGACGCAAGGTCCCAGTCGTACACTCTCCATCTCGAAGGCACCCAGCACGAAGCCTGCCTCTCGGAGCATGTCGAAGAGCGCGT
GTACTGCCAGCCGTACGTTCGTGAGGATGGCGGCGTCAGGAGTTCTGGAAGGGCCCGGTGAGCTTGCCGATCAGCTTCGGCATGAGAAAGCTCAAGTTCG
GATCGCGTTCCAACTGCCAAAACAGCTCGGTACGGCTCAGGCCGTaatccagctcttccgcggTGTACTGTCGCCCTGCGTTTTTGCCTTCCGACTTGCG
TGGCGACTGCTCGTCCGCCGAACTCGGtgcgcgcagcttcttcttctccccCGCCGACTTGGATCCCTTGCCCTTCGCGGAGGTCTTGGCGGCGAGTGGT
TGTTGGTCTTCGGTCTTCACAGACTTCCGACCAGGGGGACTTCGATTTCCGTCGAAGACCGTGGTGGTTCCCGGAGGAACCACATCGGGAACGACGAACT
GTTCTTCGAACGACGAACTGTTCATCGCTGGCCCCATGGCCTATCGTGAAGGTTCCCTCggagctccacgacgcgGCTGGTCTCTCTTCGAACTCACTTG
CCGTCGACGACCTTTCAATCGACGGCGCTCTCGCTTCCGGTTCTTGCTTGGACGTTACCCCATCTTCCGGAGTAGTACTCCCGGGTCGCGGCACCATTGT
GGAGGAGTGCCCTCGCAAA