Description :
From Genome Similarity Track
Location :
Scaffold_176:32278- 33735
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_176-fgenesh-gene-0.5Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex

Sequence
1457 bases(100 bases per row)
GCGCGAGTTCCTGGACCAGGCGCAGCTCGTGGCGGATGAAGGCAATGGCCGCAACAACCGCTACAAGGCGCTGCTGCTCGTGGCGGCGCAAGTGACTCTC
CAGATGCACCTGTCGCTGCGCACGATCGAGAAGGAGCTCCCGCTACACTTCCAGCGGCTGCTGGTCGACGGTATTGTGGACTTTGTAGAGCAGCCCGCGT
CACAGCGGTCCGAGTTTACCAGGGATATCCAGCTCCGTCCGTTCGAGGCGCGCGTCCTACACCACCGCTGGACATTGCGCGCGCTCGTGAGCCAGTCGCA
GAACGGATACCTGACGAGCAGCAACAGCAGCGAGGCCGAGGACGTGGCTGTCAACTATCAGATGGCTCTCGGCGACCTCACGTCGAGCCATCTGCAGATC
GCGCAGAGCATTCAGGCTGCGCTGGGCGACGACGACCAGCAACACAAATTGACGGTGCAGACCCAGCTGGAGGCGTACTACGATCTTGGTATGTACTTTT
TCAGCTTCACGGCGTACGAGCGCGCGTATGGGTGTTTCAGTCGCGCCGCCGAGTTGATCGAAGATGCGATGGACACGGACGAGAGTGGTGGTGCGGTAGC
GCTGCCGGCTGATGATCATCAGAACCTTGATGGGTATTTGAAAGCCTGCGAGGCTGTTCTCGAAGCCAAGGCAGTGGCAGAGGGACCTGGTGTTGCGCGG
TCGCCGAGAGAGCAGGTGGAGACGGCTTGGGATGCGCGAGACTGGGACAAGGTTGTGGAGCTACTGCAGAACGACCTGGTTGCGAGCGAGCTGGTTCGCT
TCCCGCTTGGATACCGCGCTGCACTGGAACAGCAGGCTTTTCGGTTGATGCGTGCCAACTGCGATACGAGAGCGTCGAATGACGAGCGTCTGGCTGCCTC
GGTTGTTCGTGGCTTTTACAAGAAGGTGGCGATTGGGAACGCGATCCGGTTCCATTTGATCAAGGATGAGGACCAGCCGGAAGACGCTACCGACCTGGAG
GCGTGCGCGTGCTGTTGTGCGCGTCATATTTTAGGTGACACCTTTGTATCGGCTGCGCATGTCGGCGGCGATGAGCGCATCCAGGGGAACTTGTTTGAGG
AGCTGGCACATTTTACTCTGCGCCTCACTGCATTTCTGTTGGAGAAACTGTCCAGCGATCACCACAAGACGTCTGTCAAGATCTTTGTGTCTCATCTTGT
GGAGATGACCCCAAGCGTGCAGCAGATCGATCGTCTCGCCAAGCTGCTCGATATTTGTGGCTATAGCGTCGCTAGCGACAAGACTGCTGTGGAGACTTCT
GGCCACCAAATTCACGACCTTCTCGTTGTCGAAGAGCACATCCGAGTGGCTGCCAAGCGCCAGTGCGAGCAGTTCCGCCTGCTTTCCGACTTGAGTCGCC
GGTTCGAGTTCAAGAATGGGAAAGAGAAGGAGCAGTTCATTGCGGCGCTTCGAAGTC