Description :
From Genome Similarity Track
Location :
Scaffold_6:3227132- 3252776
Transcript NameFunction/comments
Phyin_T30-4PITG_04830Putative uncharacterized protein
Phyin_T30-4PITG_04831Regulator of chromosome condensation (RCC1)-like protein
Phyin_T30-4PITG_04832Putative uncharacterized protein
Phyin_T30-4PITG_04833Putative uncharacterized protein
Phyin_T30-4PITG_04834Putative uncharacterized protein
Phyin_T30-4PITG_04835Putative uncharacterized protein
Phyin_T30-4PITG_04836Putative uncharacterized protein

Sequence
25644 bases(100 bases per row)
TAGACGGGGCTTTCTCGCTGCTCATTGTTGAACACGGCTCAAGACTTTCCCGTGTTTTTAACCATCTGATCGACTCAAAATATCATGTGCGAATCGCCCG
CCATTCATTTGCTCGTTGGGGAGAATCTCCTGTCTGCAAGAGACACCACACTCCGTGGTGTTGTGTCTGTCGACTTGTTCGAGTCGATGCCGTCGAGATG
CGAACAAGGATTGGCACAAAGAGTACTGTATAGCCTGCCATCGATGGCTGGAAAATCAACCAGCTTACAGAATACTTCGAAGTACATGTACTTCCTATTG
GGAGCGCTACGGTAGCTCATACAGGCCTGCATGCACTCTACAGCACACTCCCATGAGCTTTAATATATTTATTAAATTCGATTCGAGATGAATCGCTGGT
CCAAAAAAATCTCTTTAGTTATTGCTTCAGGAAGCACGAAAAATTCATTTTCTTGTGAGTCAGCACTGAAATATGTGCGGCACAGCGAGGACGAGGAAGA
AGATGACCGCGATCGTAGATGTCTCAAACGGGTTGAGCGTTGTTGCGGTCGATGATTTGTAAAAGTCCAGATTCAGCCTTGGACATTGTGCAGCAAATTG
CTGCCAGCAATACATCATTTGTTCGGCATAATCCCCGGATACGATATTTCGCATGTTTATTAACGTTACGTGCAGCAAAGTTGGAAGTTTTCAAGATGGG
TCAAAAATTGATCCGATCGGCTTAAACACTTGAGCTCACTATCACTCACTTTAGGTACGATATTTAACCGGCAGGGTACTATTTTTAATAGCTTGCTTTT
TGTAAGGGGAGAATAGGCCAGCATCGGCAAATTTGACCGGAATTCACAAAACACATTTATTTAGAGCAAAACATAATTCTAAATTAATATAAATATTTGT
GTAAGCTCGAGCAATACATGTACCGGTATGATACTTCGAGGTAGCATCTCAACTAATGTTTAACATTGCCGTAAGTTCCAAAGTGCCTCCATTAGTTGAT
CGAGGTATCCACAACAGTAGCGAGCCACCTCCGGTACCCGGGAGACCCAGGAAACCTGGACGCCACCGATCCAGATACAGCGTCTTCCCTCCCAGCACCG
TCACATTTGACTTCCAAATTACAGTTTCACCCGCTGGAACCGGCACTTCGGCAACTTTGTCACCACCAGACTTGATATTAACACGCACGTCTTCCGTATC
AACGCTCTTAAACGCAATGGTGACAGTGCCGTCACCATTTTTCGTCCACATGCCGTCACTGTTCTTGAAGGCTTTCTGAAGAATCGACATTCCTAGTGCC
TTCTTCACATTACCATCGTCAATCTCTCCAATGAGCTCTGTGGGACCGCAAATGGGTTGAACGAACTCGGCAATTACAGACGAAATGTAAAACGGATCCC
AAATGGACCAAAACGAAATCGCTCTGTCTGCAATCTTGAACGCATATTCTCCAAAATTAAGAAAAGTGCCATTGTCGCTCGTCCCGGCGCTGATCAAGTC
GTCTACAATGGCAACAAAAGTCTTTCGCAGAGTTTCACGGGTGGCGTATGCAGAACCCTCGTCCGATTGCTCCAATAACTCGCTCATGCAGTTGTTCGTC
GCGATAGGAATATCGTTCTGCATGAGGTTCGACTGACTCATAATAACTCGAATGTCATCCTCGGAGATGTCTGGATTAAGTGAACGTAGCTCTGCCACGG
TCATCCACGTACGATCCAGTAGACGCTTCAAGTCGTAGCCACAAGTTGTGTTCGACTTGAGTGCAGACTTGAGCGACGTAATTTCCGTCTTTTTTAACTC
GGAGATCGACTCTCCTAGCGCGATTTTCTTCATAAATTTTGTGAACGAGCTCCAGCTTGACAGAATGATGTCCCCGCTGTAAAGGATTTCTTTCAATATG
TACTCTGCAGTCGTGAGCACCATGTCCGCGAACTTGACATCGTCAGACACTTTGCTGCCGACACAGTAGGAAATCGTCACGGGAATGTCGATCACCACAT
TGTCGATCTGGTACAGGATCGCAAGAAGCTCTTCTTGAGACGTGTCGGGGTCGTGAATTTTGATGTAGCGAATGTATCGGACCAGAGACTTGGTGAGACT
GATCATATACTTGACGCACTTGACCGCGACCTGAATATTCTTTGCCCATTTGGTCATATCGCCGTAAAGACTCCACGCGGATAGCGAGATCGCATTTTGC
ACCACGACTGCAACTTTGTAGAAAACTTCCATCCCGCAACCATCACCCTGCCGGATGCACTCGAGGCCACATTCAACCGGATACATATACGGACACTGCG
TCCAACACACTCCGAGTTTGCTGTCGAACCCCAGAGGACATGTCTTTGCAATGTGAGCCTTGCGCCAGCACGCGCGAGAAGAATAATATTGAGTATTGTT
ACCAACCCAGTTGACGTACGTCTGTTCGATGGTGCTCGTTGCGTTAAGCACACTGCCGAGTTGAAACGCTGCGTTCACTACGGCTAGTGGTCCTGCAGGC
GCTGGCATAGGTGTGGTCTCTTCGCTGTCTGAAGAGTCATCGTCGCTGCTGTCGGACGAATCATCGTTGCTATCTTCAGAGTCGTCTGGATCGCGCTCAG
ATGCGCCGCCATTAGAATCGGACGAGTGCGTGTAGTGGGATGGTCGCGCGCCAGTCGTTGCATTCTCAATATTGCCGTCGCTTGAAGAGCTAACCAAGGA
AATAGAGCTATCCACCACATGACGAGAAGGGATTACATGTACCGGCGTCGATGTCGATCTGTTGCTGATTGTGTAGATCGTCGCACACGGTGTGCCAAAG
AGCGTTGCACCAATTACGGCGAGTATCATCATCACCTTCGTCATTCTCATCGGAACTATCAGCGTCCGAGCGAAACGTGGTGAAATTATGAATGAGATGG
CTCAACACCGAGCCATCTAAAGATTGACCGTCTTTGAAACTCTACTGGGCGGTACCTTGGATTCCAATGCTGCTGCGACTTCACGAGCAACGTCTTCACA
CAAAATCACTGCTTCCAATCACCAGTATTATCTTCGACTGTCGCGCGGCACTGCGTTGAAGGGTGCAAGCTTCGTGCGCCACTCAGTTGGCTCACTTGAC
CGTCAAGTTGACGTACTGGCCATCAGGATGCCGAACAGGGATTGGGCATTTGTTGCTCAAATGAACAAACACGCCGATTTGGAACGCGGCCTCCAGTCAT
TTGGAGTCCAAATTGGACACTGGATTGCGACTGAAAACAGGTTAGTACGGTATTCCACGAGAGTGGTGTCTTCAATGAAGACTCTTCATGGAGATACACT
TGTCTCTGTTGAAGCCGTTTTTGTTATAAAGTGAGAATGCAACCCGATCGCCGAAATTGCTACAAAAAATGAGAAAATACTCCTGTATTAAAACCATAGG
ATTATTTATAATACAAGAAGTATTAAATTAAAAGAGTTACCGGTAGGTGATAGGTACTAATATGGAGTGGTGCACATTTGACTCCAAATTGTGTGGTACA
CAGAAAGAAAGGAATTATGTATATTTGATGTAGATCTGCGTCGTCGCCACACATATTGCATCTGTAGATTGCGATCGTCATGGTGCAGGTCTTGCTGGGC
GCTCTCCGCGCGGCGGGGCGACGTGCTTCCGCTGCCAGGCTCCTTGCCACTCGCAGCGTATTAAGAACTGCATCTTACGCCACGCAGTCGAGTGGTGCGT
GGGCCATCAACTCTCCCGACCGCAAGTTATTCAGATGATCATGTGCAACTTCTTCTAACGCGTTGCCATTTTTTGCAAAAAATGCAGTGTACACATGGGG
CAACGGAACATTGGGTCAGCTTGGGCACGGGTCTGTGATCAAATCGGGTATCCGCAGCGCGTACGAGGAGCTGACGCCCAAGCTCACAGAGGCTTTAGAG
GGCAAAGCCATCACGCACGTCGAGTTCGGAGCCAGCCACAGTGCAGCCAGTACGTTTCCATCATGCAATTAGTACTACTAGTATAATACTGACCTTACGT
ATTGCTATGTGCAGTTGATGAGGAAGGAAAACTCTACGTATGGGGCAGCAACGAGTACAGCAAGTTGGGCCTCGGCGAGAGCAGTGAGATGGAGACGCTC
CCACGCGAAGTGGAGGCTCTCAAGGGCATCAAGATCGTGGACGTATCCTGTGGCGATTATTTCACGGCTGCAGTGGACGAGGACGGCAAAATGTACTCGT
GGGGCTGGGGAGGGTCCACCATGAAGGGCGCTGGAGGTCTTGGCCATGCTGGAGGCAAGGACGAGCCCACGCCACGACTACTGACGACGCTGGTGGATCA
GGGTGTACCCATTGCTACAGTCGAATGTGGCGAGTTCCACACCGTCGCGCTTACTAAGGACGGCGAGATCTGGGCCTGGGGTAATGGCGAGTACGGACGT
CTGGGCAACGGCGAGTCTGACACGTGCGAGGTGCCCGAACCCATCGAGTTCTTTTCCAAGGACAACGTCGTGTCGATTGCAGCGGGACGGGACTTTTCCT
TCGCCCTGACAGACAAGGGCGAGCTGTACAGTTGGGGAGGCAACAGCCGTACGTTGGGGTGCTCACGAGGACGTGGGAGCGATGTTGATACTTACTTTGT
CGTTGTGATACTGTAGAGAACCAATTGGGTATTGGCGGTGGTCTGGCGATGGACGTGTACAACATCGAGTCGATTCCTGTGCTAGTTGAGGCGTTCAACG
GCCTCTTGGTGAAGCAGATCGCAGCTGGTTACGACCATGCAGCTGCTGTGACTGAAGACGGGCGTCTGTACATGTGGGGAGCCAAGATCTGGATTGAACC
GCACGAGATGACGGCCGTGAACGAGCACAAGATGACGCAGGTGGCTTGCGGACGGCAATACACTGTGGGCTTGACCGACGACGGCAAGGTGTTCACGTTC
GGCAAGGGAAGCTCCAACTGTCTGGGTCACGGCGACCGCAAGAACCAGCTGCAACCGGTGAAGATTCAAGCTCTGGCTGGCGTTAACATCACGTCGTACG
TGACTCCTTAACGCATTCGTTATAACTGTCAGCTAACCAATTCGTCTTCAATTTTTGCAGGGTCTCGTGCGGCGACTACCACATGGGCGCCATCGCGACA
CCTCACGCGGAGGCAGCCGACAGAGACTTTTCCTTCCGGGAGTAGGACGTAGCTCGAACGTAACAAACAACTCGCTGGTGGCTCGATGTGTTGATCTTTT
ACTTAATTCAAATCGACACGGATGAACCGTCGCCTCGATCTTTTTGCACTTGGGGTGTCCATGATTCGCATCGCGTTGCTGTTGTGTGTAGCACTTCCGC
CGTGGCTACTGCTGATCTCTGGTTCTTCCGTGTGGTCGCTCTTTTGGCGACCAAGTGACGACGTCTTGCTGGGGACTTCAAAGCTCGAGTGGCGACAGGT
GCGCAACGTACTGCGCTGGTTGGAAGGAAGACGAGATGTCGTGCTCTCGCTGGAGACGTGGCCTGAACCAGACACCGACATGGACGAGTGTCTAACACGC
TACCGAGACGCCAAGCACAACGAGATCTGCGTCATCAGCAGCTAGAATTAACAGCAACTTAACTCGTTATTAATCTAACGTTCTATTCAAGTTCTATTAC
TTGCCGTCGCGTTTACGTTTAAGATTGTTACGGCTCTGCATGACAGCGGACCCGGTGCCGTCCGATGCGACGACGTCCGTGACAATGTACGGAGCTTGGG
CCGGTTCTTGAGCCGATAATAAGATGCTGTCGAGTGGCATGCTGCTGCGTATTAAGAGGTTGATGCGCTTCAAGACGGACAAAGGTAGAGGACTCAAAAT
GAACAGTTGACGCTGCTGGGCATCCACCGCGCGGATGATCCCGACGCCAAGACACGGCGCATGAACTGGCTGCAGTACGATACGTGGCGGGCCCTCTCGT
GACTCGGCTTCGTCCTGTTCAACTGGTTTGTAGTCGGGGTTGACACAGAGACCGACGACGCTGGCATTAAGCGAGAACAGGAGTTGGCTTGGAGCTACAG
AGGAACCAGCGAACGCGACATCCACATGGTCGAATGACACGGCGAAAGGTGTGAGTTGCGCATAGGCGCGGTAGATGTCACGGTCTACGCGATTCTTCTC
GGACAAGACATGAAGATTCTGTAGTTGCGATCGCGGGAGGTCACATCGGACACGAGAGAGGAAGTACGAGTGGGAACGATACACGCGCAGTTCCTTGGAG
CTTCGTGGCGGTTGCGTCACGCCCACAGGGTCCCAAGGAGGGACGGCGTGTATCCGCCATCGGCCTTCTGTGGGCACATCGAACTGTTTGTTCTTCGTCG
CAGCCACAAGCTGCACGACGTGATCAGGGTTCGTTTCCTGGATGACGTGGCAGAGCAAGTCGTGGCCCATACTCTTGATCCACCCGTCGGTGTTGATCAC
CAGCGGAACACACGCACGTTGTCTTTCGATTGACTTGTCCTGTGCTTGTCTTCCCCATTTGCCTTCGTACAAACGTAGTAAACCCTTGACTGCCTTCATG
TAGTACAATGGATCATTGCCGGGGTTGGTGTTTCCGCAGAAGAAGGAACGGATCGGGTGTTTCATGTGCGCAAATCCCGGTCCAAGCAGCGGAGTCGTCA
GGGCATGAAGCGCTACAAGACCCGACGGAGTCAGTTCGCTCTGTCCCAAGTCCGTGTCTAGAAATGCCACGGTGTCGAACTTCGAGAGCAATGTGTTCAC
TAAATATCTACAAAACGTGGACTTCCCCACGCCCTTGCCACCGCAGACGACGATCTTCTGAGGGTTCTGTGCCACCAGACTGGCCTGCAGTCTGTCTACT
GTCGCTTGCCACGGCTCCGTGAAATTCAGCGTCTTGAAGGAGTCCACGACGACAAGCTCGGCCAGTACGCGCTCCGGCGACTTCCAATCGTAATGCGATG
GGTCAGTAGTTGGAGGTGCAGCACTTGTGTAGTCGAACCCTGCAGTTAACTCACTCAGCAAGTTCTGGTTATGTTTTGAGACGATCATCTTAAAACCAGG
CAGAACTGCCGACGGCTTCTCTGGTCTTGTATTCTCATAGAAACTCATGATATTCCCGTATGTCAAGGGAATGGCGCGAAGCACCAGCACGATGGGGAAG
GCGTCTACAAGTTGCATGGCCAGTTTGTCCGCCGCTATCTCTTGGTCCTCGTTCACAGCCTCAGGATGCAGATTCGGCTCCATGCCTTGCAATAAACTGA
CATTCATAGGTCCAAAAGGCGCCTGAGTCTCTTCATTACCAGGTCGGCCCTCTATCACCAGCAGATTATTCCATTTGGGTGAATGCAACGAGAAATACAC
GCCGAGAGGTGGGCGAAAGCCCAACACTTCCACGTTGCCCTGGAAGACCCGAAAAAGCGCCATACCCGCGCAATTTACGGACGCGGTCTTCTGCATCCCC
AGCGCAACCACATTGCCAGAACGCACGCACAAGGCTCGGTATAACGGAGATGACGCAGCCTCGCCAGCCGCAGGGCCGTAGAGCGAAATGTCGGTCATCG
TTTGTGACATAGTGGCCACTTGTAATTTGAGGGAATTCTCACACGTCACATGTTTCCAAAATGAGGGGATTGAGGCATTTTGCACACGTCACACATTGCA
GCTTTAACTTGTTGAGTAAGAAGGAAATAATCATGAGCTCTTCTCTTCAGGCAGCGTCGACAACGCCTAAATGTAGTGGGTAACTATTTTCGTGGGGACG
GCTGGTTGGTGATAACTGCTCACTGCTCGAAAATGTATGGTTTGCCTTTGCTCTCTCAATAGCAACGCTACAACCTGAAAACGCTCGATAACAGCTCAGA
GGTGTCAAGCACTGCACCCCGAGCATGTTGCCGGCACTCACCACCAAGCCGAGGCAGGCGGTGCGTCAGGTCAAAGGATTGACGAATGACTCCATCGACT
CCTACTCAAATATGCCTCTCGGTGGTAGTGCGTCGACGGCGTACGTGGATAACACTGAGTCAGGGAGCGGGACAGCGCACGTGTCGCCACTAGCATCAAG
TCGAGCGACTATTAATACAGGACGTGCAAGCGTTGCTAAGACAACGAGTGGCGAGGATAGAGTGATGGCTCGTGTCGTACGAGACCGAAACGCGTCAGGA
GAGGAAGAGTTGTCGCTACAAACCGGAGATGTCGTCAAGGTTCTCTCCACCAAGCGTACGGGGTATCTCAAATGTGAAGCAGGAGATGAAGTAGGCTACA
TACCGTCATCTTACTTGGAATTTCTTGACGTTTTTACTGAAGTAGAAAACGGAACTAGCAACGGAGTAAGTGAAGAAGCTCAGCGAGCAGCTGAGAAACA
ACGTAAGAGACAGCAGAAGAAGGAGAAGCGTAGGAAGGAGAAACGGGAAGCCAATGAAGGTAATGAACTGAACGAAGTAGTTCCTTCTACTGCACGCTCA
CCTCGTAAAGAAATTACTAGTGGAGACAATGAGGGCACCGACTCGCCACGCAAGCGGAAGAAGAAGGAACGAAAGCATCGTGATCGCGAAGCAGGTGAAG
AAACTCATAGAAGTGCAGCTAGTGAGGAGCCCTTAACCGCGAGATCTCGAACTGGTGAGGACACGGAGCGCTCTCGTACTAGAAGCAAACACTCGAAGAA
GAAACGCCATCGAGACGGAGGCAGTAGTGGCTCTAGTGACAGTGACAGCGGGAAACGTAGTGCTCGACACGGTCGTCGACGCCGTCATCGACGTGGATCA
AGTGGTAGCGAGTCCGATGCAACATCATCGGACGCCTCGGATGCTAGCTTCAGACGGAGACGTCGTCGTCGACGTCACAGACATCGACGAAGCTCTAGTG
AGGACGAAGATGAGGACGATAGCGATCACAAACGACGTTCCAAACGTAGCAAAAAACGTCGTGATAAAGGTGGCGACGAGTCTGAACCCGAAGAAGGTTC
TCGCTCAGCTCGTAAAGCTGAGAAGAAGAAGTCCACAGCAGCTCTACAAGAAGTGGAGAAAGGAGTGAGTCAACTGGATGTGAGATCCGACGAAAAGCCA
ACGGAAGCGAAAGTCACTCCGTTGTCAAGCAAGAAAGAGGAACTTGATCGAGACAGAGACAGAGGGAAGAAAGAGGAGACTGAACGTAGTGAAGGCTCGT
CAGAAGGACGGACAACGACCGTGTCTTCAAGTCGGAAGGACGATGAAGGTCGCACAAGTTCCGGCGCTCTTAAGAACAGCAAGGCAGGATTTGGCAGACA
AATCGGAGAGAAGATGCGATCATTCTTAGGTGGAGGCAGCAAGAAACAGCACAGTAGCAAGAGCTCGAGTGGTATTTTGAACGCGTGTCCCGGTACCGTA
CAAGGCGAGGAAGGCTGGTACGAGCACGGCGAGAACGAACGCTACTACTTCGTGCTTGTCGATGGTAAATGGAGTCTTCTGTACGGACCTATGACGGAGG
ACGAATTTGAAGTCTTCTCCAACCGGGTACGAGTCCTCAAAGTTTTTTGCAACCATATAACCCATTTCTAACATCCTATCGTTCAGGTGTTGGAGCAAAA
TCGCCCTATCGAGTTGCCACCAACGTATCTACACAAGTCAGGTTACTATCTCAACCGCGAGCTGCGTGTTCAGAGAGAGCAGTGAAAAACAAAGCGTTAA
CAAACTATCACTTACCGACTTTTATCCAAACAATACACGAAAAACTCCACACTCATTAAAGAAATATAGTTTTCATTCATTAAAAACAATCTCCTATATT
GTGGGATTGCCTGGGGAATCGATGGTTGTATCCAAGACAAGTTGTGAGGGGAAATAGAGTTCGGGTGGGATACTCCTTTCGTGCTGTCCTGAGCTAGTAA
ACCATTGCGTAGGCGATCGCAATAACTCCTTCAGCTCCTCACTTAACGAGAGTTTCCGGCGTGGAGAAGTCGGTTGGCTTGCAACCTTAGGAGCTATCTC
CACCTTTGGCTTGGCTTTGCTCGGGGATGCTGCTGAAAATGCCGCGTTCACTACAACTGCGTTCCTCACAACCTTCCAGCTCGTCTGCTTCTCATTTGGT
GACAAAGGCTGTACCGTTCGCTTGGAAGGGGATAGCTCTTTCCATGCTGTATCGTCCGCTGGTTGATCGACGCTATGGTCTTCGGTATCCAGATCCAAAC
GTAGACTAGACGACTCTTTCCGCGGTCCTAGCCGCACTTCATTCAGCTTCCGGTCCACAAACGTCGCCTGTAACTCGGGAGCCACCTGCTGCGCACAAGC
CGCCACCTGGTCTTCACTCAACTCCTCCGAGCCAGCCTTACCTTCCGTGTGATACTGCATTTTGCCTAGCAACTCTGGCGTTCGGGTGATGCTGAACGTG
CCTTCCCTATGCATCTTCACAAGCTCCGCGAGATGTTGTTGATGTGGCAGCCAATGCGTGGCAACCGTGTGATACGCTTCACGATGACGGTCGTTCAGTC
CCTTGGGCACCACACACACCTGCTCGAGCTTATGTAGCAACACTGGCGTCTCTTCTGAGTGCAGTTTGCGGTTGTTCATGCACCGTTCCGCATGTGTCAC
GAGCTTCTCGAGCAACGTAAGGTTCGTCTGGTATCGTTCTTCCAGTTTCGTTTGCGCCTCTTGCTCGCGCTCTCTCAATCTCGAACACTTGTCACGAACT
TCTCGCAGTAGTTTTTCCGTCTTCACCATGTCCATCTTGTTCGCAGCCTCAAACACTAGTAGACGATCCAGTAGGACTTTGACGCCCACGCCTTCTCCAA
ACTCATGATCGCACCACCCAAGTCCACGTTGGAGCCAGCGGCTACGTAGCGTGAACGCTGCTGACGCCCACTCCAGTCGTTGGCGATGCGCTGCACTGAG
CTTCCGCTTGATACTTAAAGTTGACGCGTCAAAGCCAAGCAGCCAGTCGGCGATCGACTGGCTGAATGTATGGCGCGTTCGCTGCTTGGGGATAGGAACA
CCATCCAGACTACTGCATTCGTCATACGGGAAGGTGTCTTGCAGTCGGCCCTTGGCCAGATCCATTCGTGAGCGGAAACTCGTCACTTCTTGGAACACGT
TAGCAGCATAGCTAATAGCCGCGTAGTGTGCCATCGCGCTAGCATTTTCCCCTTTTGGACAGTGAGACAACATTTCATCGCTCGGCGTACGAATTCTTCC
AGTAGCGACAGCTTGGAGCAGTTCTTCTCTCGTGAAAGCCTCGGGAGGCAGTCGATAGTTGGCGCCAATAACGCGCTTATTGACGTTGTGTAGTTCCATG
GCAATCTCTTCCTTCGTCACAGCTTCGTCCCTAGATTTGCCCAGAAGAGCTCGCATACAACGATCCAAAGCTGCGTACTCAGCTAGTCGTCTCGTGTAGG
ATTCATGCACTAACAGTCGCTGGAAGCGCTCGACAAGTGTCAGGTAGTCTCCACTTACATCGATTTCGGCGTTCTCGACTGCAGCAGCGAACATGTCGGC
TTCTGTTCGCTCGCTTTCTTCATCGAGCACATGAGATTCTCCCGCAAAAGAGCGCACCAGAGAGTTCCGCTTACGCAGCGCTTCGAACAGCAGCATTCTA
CGCAGAGCCTCGATCTGTGTGTCAATAATACCTAATCCAGTGTTGATAGCCTTGGTATTGGACGTCTGAGTACCAATACGAACTCCACGAAGCATGACGG
GCTCGCCCTTGCGGTCCATTCCTCGCTCCTCAAGTAGCGTTTGGATAGAATTTACATCCTGTGGTACAGTGACCTTGATATCGTGTTCGTCCATTAACTG
AGCAATTGTCATGGGGCTCGCCATGCTCGGAATCGCGATACCTTTGGCCAATAACGCCTCCTTCTGCAATGTACATACTAGCGACTTCATCAGATTCTCA
ACTTCAGTCGTAGAAATCTGGCGAATTGTCATCTCTCGCAGCAAAATTTGGTAGTTTTCCGGCACAGCGAGCTCATGGTTTCTACTCACCGCGTGACTGA
CTTTCCAGAGCAAATCCGTTTTCCCGAGACTTTCCATCGCTTGGTAGAGTTCCGCGACACGTTCTGGGTTCGGTAACGTGAGCGGTCGATTGTTATCGCG
CTGACTTTCGAGAACTTTTTCGAGTCTTTTGATCTCTTCGTCCACATGTTTGGGCAGCACAACCGACTGAGAGCCGGACGTGGCATCCAACAGAGACGAC
TTGACCCACGCATCGTCCTTTGCATTGGCATTAGACGTCGACGCAGCGTTGAAATCAACCGTTGACGTTTTTGGAATGACGCCACGATCTTCCAGTGCCA
GACGCACGTTCGCAGACGTGAAGATCATTTCTTCCTGAGTTATCAGCAGACGTGTGTCTTTGCCATCACGTGAGAACGGTAACCAGTTCTTCTTGTCGGT
ATCCGTCGTGATACGATGATAAGGAATCCGCTCCAGTTCGTACCTGGCTTCTTCGATAGCATACCATTCCGCTATGCCCTGCAATTGTCCACTGTCTTCA
GTATCACTTTGAGACCTAAAGCCCACGTCAGACGACACAAAATACTGTCGAGACAATCCGCGTTGTCTGTCTGAAATCATGGAAGATGCTGCTGCTCTCT
CTCGTCTGTTCGGTTCTTCTTGTCTCTTTCTACGCGCAGGTCTCCACAACTGCATCTTCTCGAGGATAAAGGGTGTGTGTTCACTATCAATCGAGTGTTG
CGACTGCATCTGCACCACCTCATGGAGCCATTCTTGCACTTGTTCCCATCGCTTTTGGACCGTTTCCAGCGCTCTGGCATCGACGTCTGCAAAGCCGTCG
CATTGTTCATCAAGTAGCAGCAATAGCTCGTGTGTGCGTCGCCAATGCACAACCTTCTTCTCCATCAACCGAAGCTCACTTAAAGGTCCATTAGGCTGCG
TGATCGCCATCCAACGAGACTGAATCTGCGAGACGGCGTCTGCGTGGCGCGTGTTGAGTCCTTTACTGCAACGTTGCTCGACGGTACTTAGTAGCTGTGG
CGCACGAGCCAAGTTGAGCTTGCCTTGATTCATCCTCACGAGCTCCTCCAAGACATCCAGCAACGTCTGCCATTTCTGCTTGACCTGCTTCCACGCCGTG
CTGAGTCCTACGTCGAGTCCGTCAATCTCTTTCTCGATATCGTCAAGAATGTCTGGCGTTCGCTGGGCGTGGATCTGGGTGGCAGTCTGGATCACCAACA
GCTCGTCCAGCTTCGGTTGCAGGTTCACCCAACGTGTGTGCACTTGCATCACTGCCCCGCGATACGTATCTGCCATTTTTGCCACGCTTTGGGTATATTC
CGCTTCATCAACATCCGATTTCTTGCTTGGAGTAACACTCTCCTGCAAGACAAAGATGTCCCAAACGAGACTAAGCAGCACCGGTGTACGCTCCCAGTGT
AGCCTGCCATAAGCTTGTAACGTCAGCTCATCCAGGTATCCTTTCATAGTCGTCCAGCGTCGACGTTGCGCTGGCACGACAGTGTCGTGTATACGTCTGC
GTGCTGCTTCGTGTTGCGCGATATACTTGATTTTCCAGACCTTGTAGACCTCGATCGCTTGCTCAAAGAACGAGCTCTCCGACACCTTCAAGTGGAGACG
CAAGCGTATCTTCCCCCTGTCATTCGCTCCACGTGGATCAACAGTATGTTTATACCCACGTGCACTAACCGAGGGTAAGTACAGAAGCTCGTAGACGTCG
TCATGCGGCTGCTGGTCAAGCAGATCCATCAGCGGGATACACGCCGTGCCTACATATCCATCCACCTCGTTACGGTCTTCGTCCATCACTTGTACACGCA
CTGACGCCTTCAGGATCATGTCAAGTACTTGGACCAACTTGGTGAGTCGACGACGTTGATACAGCTTCAGACGGACTTTTTGATCTTCAGGTTCCAGTTC
TTCCACCTCGTTCTCAAAGAAGGACAACAAGTGCTCGCCTTTCGTCACGTCTACATGGTCGTCATTTGCGTCCAGAGCGTACAGCTCGTCCAGCTTCGGG
ATGAAGTGCTTGGTCAGCACTTCGTGCAGCTTTAAAACAGTCTGCTGCACCCGATTCGAGCACGTCGCCACGTTGGCTTCCACTACCACTGTATCATCGC
GCTTTCTGCTCTCCTTTTCATCCACTTGAGTCTCAGAAGACCAAGGTAGTCGTCTCTCAGTCACGTAGTGACCAAGTCCCAGCTCGTGTGCTGTATCCTT
CACAAGAGACTTCGTTTGTTGCAGCGTAAGTTGCAGCGTATCCATTGCTCGAGCCTTCAGATCGTCAAAACTCTGACTCTCGTTTGAAGAAGATAGAAGC
GTCACAGAGCGAGAGGTAGAAGACTGCAGTTTGGTCCTTGCCACAAACCTCTGGACCTTCACAATCTTCTGCAGCTGAAGCTCCATATCAGCAGGTGTGC
TTAGCAACACCTTCCCTTCACCAGATACAGGAGCTCCGGCTGCAAGAAAGCTTCGAGCGAGCTTACTTTGCTGCTCTTCCAGCGTCAACTTGAGTAGTTC
TTTTGGACAGATAGTCCAGAAGTCCATGGGTTGGTCAAGATTTTTGCAATACACTTCAGCGTTCACACTATACTTTTGGATACGCTCAACACTCAACGAT
AGCGTCCCGACAACTACACGCTTCCCGTCAGCTCCATCGCTATATATCGGCTCGTCCTTAAGCTTCTCAGTGCCATCTACGGACCGAGACAAACTAATTG
ATTCCATCGGAATCGTGACTATTCCGAGCTGCGTCCGGCTTTTCTTGTCTCGCACAGTTAATCGCACTTCCGAAACACGATCCAAATCCATCGTCGGGTA
CTTAAATTCCACGTCACAAGAGCCGTTCTTTACCCTCCAAGACACTGACGCATCTACCGTTTGCTTCGCCACTTGAGTGGCATCATACACCAGTGTGAAA
CTCGAGTTCTTGGGATAGATATCCGGCAATAGCTCGCCCGATGAAGAGACCTCCAAGCCGAAAGAAGTGAGCCTCTTGTTACCGCCACTGACAGTCATGT
GCTTGTCAAAGTCGCTGGAAACAAGCACCACTTCCACTTGGAGTCCGTCGCTTCCCATTTTCTCTTTAAATTTCATATTACTCGCCTCAAACACCTTCAC
ATGGAGCGAGTCAAATCGAATACTTGCGCTGTAGACATCCACGTCACCTGCTCTCTGGTTCGTGTCAGCGTTTGCAGCGTTGGATTTACTGGTTGAGCTG
GGTAGAAACCTCAAACGGCAACGCGTCGATGAGGTTTCCGAAGGTGGAGAAACGACCATGGCTTTGTGGAACGGAGCAAGTTGTCTACGAACTCCAGCTT
CGGCTACGATGTCGTCAATTCTAAAGTGCAGTTCGTGGACCTTGTCGTCCAAATCTCGAACACTAACTCGAATATCATCGAGAGACTCGAGCGAAACTTG
GGGAGTTAACACAGATCTTCCAGGTGGACTAGTAAAATCAAGAGACAGTTCCATACTGGACTTGACATTGTCCTCGGAAGTCGTCAAGAACCACGACAGC
TTCCGCAGATCAACCGAGTCAGGTGACAGCATGTTCACGTCCACAGCGAGCGTGTTAACAGTCTGTAGTCGCGTCGAAATGGCCGTTGCTGTCTCATAAG
CAGTAGACACAGCTTCACTGACGTTCCCTTCGTCATTGTGCGGTACAGACAGCTGGAACTTGATGTCAATGCTTGCATCTAGCCATGACACATCAGCCAA
ATTCGCATCAATGGCTACATTCTTTGAACTTGGCTGCGTCGGATCGAGGACCACATTGTGACTGGAATTCTTAGCAAACTCCACTCTCACACGTTCAATA
ACCACACGACATTCCTTGCAACCCGATCGTAGGTATTTACAGCCTTCCGCACGCAGCAATCTCTGAACGACTGTCACAACGGAGCCCGACGTATTTCCCA
ATGTAGCCATGACCAAACCTTTGAAAAGTGCCTCCGAATTCGGCGAGGAACGTACCCGGACTTGTCCAACAATTTGCACGCGTGGAGGTGGCGCTACGAT
CAAGTAGAAGCAGTTCTCCTTACTGAATTTCGGTAACATCTTTGAGGCTCCAGTGTGTATACGACGTCTGCATACAGCACTGTATACCAACTCTAGCTGC
TCTGCTTCTTGCTTGTCGAAAGTCTCTCCTTTCACGAACCCGTGGTACTGACCAACAAAACGCGGTTGGTCTTCGTTACGCTCCATTAGTGTCGTTGGCA
CAAGTTTGTTGGTCGTCGCATTGCGAACTTGGAGCGACTTGACTGCGCCAGGAAGAAGCGCGTATACTTTCACGATTTTGTCACTACCCCACCAGAGATT
TTCCAATGTTTTGGCCATGCTCCGTACCGAATCGGGAACATGACAATTTGTACCCAGCGTCGACAGCTTCGAGCTATAAACTGCGCCCAGAAATGCCGTA
TCGGCCGCGAGGACGCCGTGGCGTGTTCGTATTTGGGTGCGTGATAAGTTGTGGACCGCTTCACCATTCTCGAGGCACACAGTGTACTTAACTGCTGGGG
GGGGGTCAGTTGAAGCTGCTGCTGAAGCGTAAGTGCCAGTAACTTTCCCGGCATACATAACGTCATTGCACATCGGAGTCAAGCGACTTCTGTTCACCAT
TTTGGCGTCTACGGGCACTAGTCCATCCGTAAATGCGACGTCATATCGCGCACCACCATGGCAGTGTGTGATCTTTCCAGAGCGTGTTTTACCTGTAAGG
ATTGCTGAGGAACTGCCAGTCTTGATATCGTCCGAGGCTTCCGAGGGGATAACGTGCTCTCCACTAATGTAAACGAAGTCGTCGGGTATCAACACGGACT
TCAACAACTCTCCCTCGACTTGCAAGACAATTGCGCTCATTAACAAGTGCGTTCTCCACTCTTCGTGCGGCTCTGAGCTGTCCAAATATTCAACCAAGTA
CGGCGCGTCAGGGTGCTTGGTGTTGTCATACTCTTTCAGTTTGCCAAGACGCTCTTGTGTGTCACCTTTGCCGTCATTATCCGGAAGAACGGTACAGATC
TTGATGTTAAAAAGCCCTCCTCCACACTCCTTGACTATCCGGGCGGCCACAAAGCGTCCGCCACGTAACTGGGTGTCTACAACAACCCCAGCATGCTTAA
AGAAAGGAAACTTCACAGTCACTCGATCGTCAACACAGAACGGACTGATCCACCTCAGTGCGTTGGTTGCAGTCTGGTTATCCTCTCCACTTAATGACAG
GACGTTAACTCCAGTCCAGTCGCACTCCGTAAAGAGCTTTTCGATCAATTGCGGTGTCTTCTTGCCGTGACAATTGCCAGTCAAATAGTCTCTAGCCTCC
GTCACTTGCATTAAGACACGGGACCATCGATGAAGCACAGCGTCTAAGGCTACTGCATTCGCATACGACAGACGGTCATTCTCTCCACTCAACAAGACGA
GTTCGAGCACGTAGCCCAGCAGTTGAGGTGTCGCTTTCCAGTGAAGTGTGAGCGCTTGACTCATGACACGCACTTGAGCTAGCAACTCCTCCGCAACATT
ACGTCCCAGGATCAAGTTCGCTTGGCAGTGTTCCCACAGGAAAGTCTCGACGTCCTTGTTAAGTTGCTCCAAGTTGTACCGTCCACCGCTATGGTTAAAC
GTTCGGGAGTCAAACGCGAGTCCAACCAACCGGAAAGTGTCGGCCACGAGTCTTCGAATGCGATCTGCTCGCTGAATTCCAATCAAGTTTAAGTCAAACT
TCAGAGCCACCGTGTCCTTCGCGTCACGCTCAGTCAAGACCACGGTTTCGTCTCGGAAGCTCGCGCACTGATTCGGGTTTGTCAACGAGAATTCCGTCGC
CCCATCGGACTTACCAAGTTGACCCTCGAAAACTCTACCAGTCGACTCGGAAGCCAAACGCACGTCGAAATAGTTCACTTTCGACAAGTCGTACGTCCGG
CCGAGTATCTTGAATGCTTCTGCGTAATAAGAGGAGCTCGCTAGCGTCGCTTTATCTGAACTCACTAGTGACGCAGTTGAGCTGAGAAGATCGCTGAGTC
GGTATGAATTAACAGCTCCTAGGTCTTCAGAAGCAGAGTCGTATTTCATCTTAGATCCACCTTCTCCATGCGGTAGGAAGCTGCACGTGTACTTGCTCCA
GTCTTCCTGAGCTCCAGTATTCTTGGTCACCTTCTTGATCGCAATCTCCGCCGAGTAGTTGGTTGTTACTGCTGCTTCTATTGCTGCTTCGTGTCGGTTC
TCGGTGACATTCACTGAGATGTCGTTCCGGATAATCTCCACGATGAAGCGCAATTTCCCCAGCACTCCATCAGGCGCAGGCTTCTTCTTTATCTTCTGCT
TACCCGAGACTGGAAGCAGCATCGCGTCTACTTCAACACGATGTTGACCATCCAACGTGAGCTCTTGTGTGTCTGCATTTCCGTAAGCATCAGCCTGCTT
GAGTACGAGACCTCGGATGTATCCGTTCTCCGTCCGTAAGAACTCAATAGTGACACAACCCATCGGATCATTCGCCGACGCTGCATCGTAGTCCGTCACA
CGCAGCAGTATTCCCTTCTTATCACTAAGCCTGGTTCTCTCCGATTTCCCCAACAAGAACTCCTGATTCTCCCATTTCGGGTTGAGCGACTTCATCTTGA
CGTCCGTCTTGAGACTCGTATCCCGCTCCTTCGAATCTTGGTCCAACAAGAAAATTTCCACGAACGGATCGCTTGTGAGCATGTCGGCCACAGGAAGATT
ACGTCCTTCCAGGATCGAGACCTTCACAACGGAAGGTTCTCTACCTACAGCAAATAAAGCTTTGCTCTTACTATCTTCTTTACTCGGAGAGAGCGTCGCC
TTTGTATCTCGTAGCGACGTGGATTCTACGTCTTCTGGGATCGAAGGAAGCTTTGCGCTTCGTGTCATCTCTCGCTTCTGCACCAGCTGAAGCTCCACTC
TAACCTGACCTAGATTTGTCCTCTGAAGCATGTCACTAGCAGGTGCTAGAGGATACCAGGCGTCGATTGGGCGGTGAGGAGAGAGCATCTTTGTATGGAT
CTTGAGAACGCCCAGTGGTTTGTGACGATATCTGTGCTTCACCATGCGCGAGACACAATCCTCCAGATCTGTATTCTTGAACAAGATATTGAGATCGAAG
CATCTTTCACTCACCTTTTGAGGATCCAGATCTCCCTCACTTGTGCGGATATGGCCTCGCATCAACCCTTCCTCGACAATCCGTTCGTTGGCGCGAGTGT
ACTCGACGTCGTAGAGCAGAAACATGTCACGCTGCGCCTTCGATAGACTCAACCACGACGCCTTGTCGGTCACCTTGTACTTCGTTAAGAGCTTGGAAAG
TTCTGCTGGTACCTCGTTAATGTCGGTCATGTCGTACGCTGTCTTGAACGGGTATTTTTCGTCGGTAAATGGGGTACGGATCCGTATTATTCGTCCCGAA
TACAGTGAGTCGTTCTTAAAGTTCCCACTGTTCACAGGCTTCGATTTCCGGATCTTACCTCGGCCGTAATATGCCATCACCGTGTCTCCTTGCGCTCCTG
CTTTCTTCAGCTCACTTCGCACTTGAGTACGGAGTTCTCGACGCTCTTTCTCATAGTCTTGATGAGTTAACCCTTTGTCATGACCGAATAACCGATTCAG
TAATCGCTGAAAGCTTCCCTCGAGGTCATTCGGGTCAAACTCCGTCGCGTGTTTGTTGCACTTTTGCTGCAGAATAATTGGATTAAGTCTTTTCATGAGT
ACTTCTTGGCCTGGTCGCATTTCCACGCAGACACCTGAGCGAGCCAGCGCCTGAACCCACTTCTGCGTACTTGAGGTCTTGACTTCGATGACTTTGTCGC
CGTTGAGGCGGGTTTTGGTCATCTTGTCGAGTACATCACGAGTTACGGGCTCAAAGTCGCTCGAGTTGGGCTTCTTGACACACACCGTGGGGTTCACGAG
ATCCATCCATCCGCCATTCGCGTCATTCGAGAAGTTGTACGCAGCTTTACAGACTGCACTCGCCACATCGATATAGGCCACAGGAGACGTCGACGTCTCG
TTCTCGTAAATGTACAAATGCTTGCGACTCGGTACGAAGAGACAATACTTCCAATCCCATAGAATACTCCCAACAACTTGAGTGGAACCTTGTTCCTCAC
GACTGATAACTGAGTCCTTTGCGGTTGTTCCAACAGGATGGTCGCTGGTTTGCTCAACTAATGAAGGCAGGAGAGAGTTCTTCCAATCCTTGACAGCAAA
TAACACACTGGACAGCATGGTGTGCATTCCTAGAGAACCGTCACAGTACTCCGTGAGCTTATTCGCGTACGTTTCGTCACGCTTAGTCGACTTCTCCGTC
TCCGTGTTAGCTTCAGAAGGTTGCGACTGACCACGGTAGCAATCGATCTCTCTTACGAGATCCAGAGGGAACAAGCTGTTCGTCCGTGACGAGCTCTCCA
TCCACATATCTACTTCACGTAAGCGGTAATAGCGATCATCTCGGCATTCCAGTAGCACGGTTCGTTTGCCAAAGCCAAGCTCTGGAGTCACATTCTCCAC
GTATCCAGCAGCACATAGAGCACTCAACCACTGCAACGCATGCACGTCGTCCATTGGCGCTTGGAGCGCATCCGGATCATACTCTAAGCTCTCGTTCCGC
CAGTCTAATTTACACGAGGATATAACTGCCGCGTCCTTGCAATAGACTGTCCACTTGTCGTCCCACAAAACGGAAGGTCGGCGACGGAACCAAGCGATGA
TGCCGTCGCCAGTAAAGCTCCTTGGAACCGAGACGACCAGCGCACTTGTTTGTTCTCGCATGAAGAAAGTCCCATTCTCTCGAATAAGTTTTTGTCGCTC
TGTCCGTAGACGCATCCACTCGTCTCGAGATGTATCTAAGGCAGGGTAAGTGCGAGGCCCGGGTACGGCAGCCAAGTCCAGGAGCTCATTTTCAAGTCCG
ACCACGATCTCCTTCCGCACTTCATGCGACAGTTTATCCATCGTTCGACCCAAGAACTCGCTGCCTGGATCAGCGTTCACAGTGTGCAGTAAGCGAGACT
TGCTCATCTCTTCAACAGACAAAGTCTCGAACGTCTCGAACTGCTGGAGTTCGCGCAAGATGCTAACAATCCGCTTCATAACGACCACGAGAACGGTGTG
CAACGCATCGATCTGAGCGTTTTCGGTCGGTGACAGCGAAGTGCGCAGAAGCTGTCGACGCTCGATCCACGTTACTCCGCGAGTAAACATCGAGGACGAC
TGAGCTTCGAGCTGAAGTTGCTTCTCGTACCACGCGCTTAGCTCGAACAAACGAGGCTGTTCCACATCTTTGGCTTGGTGGCTGGACTTACTGCTAGCTG
GTGTCAGTTTGTAGTCGTCGGACGAGGTTGTGAGGCGGACGAATAGAAAACCCACAGACTTGTAGAAAGGGATATTTGCGGACTTGGGAGGCACGATGGG
CACGCGCAGAGTTTGCTGTTTACTCCGCAACATGGCAAGATCGATCCTCGCAAACCCAAGCGTGATATCCTTCAACTCGGCATCGTTAGAGTGAGAACCA
CTCTTGTTCTGGCTTCCCATTTTATCCACAGTACCGTGTTTCTCCATCGTAACTTTAACGTTTACTTGAATCAAAATACTCGACGTGTGCTCGAGGATTT
GACACCCGATCTTGGCTTCATTTGGGTCGACAGACTGGTATTTGTAGTCTACTTTTGGTTCCTTCGGGTCTGTAGGCGGCATCTTCTCTACTTTACCAAT
CACCAACGGGTGATTCTGGAACAGGACGACGCCGGACGCTGCTGCGTCATGGTCATTCGGATCATTCTGGACTCCAATAGTAGCCTCCAATTGCTTGTCT
TTCTCCCAGTTCCAAGTTGATTCCGACATTGTTTCGCTAGCGAACAGCTCTCCACGGTCGTTAAAGTAACAGAGATTGGGCTCCTTATGCCTCGGCTTGC
CCAGCAGAGTCACACGGCAAGCTAGGTTGTCATTCCTGCCAAGGTGTTTCATCTTCTGCACGTTGCTGTCCTTGACTATAGGCACCACCACGTCTGACGC
TGACAACACGTCAATAACAATGCCTGAAACCGTGTGCTGCATCCTGGTCCACTTGTCGTTCTCCTCTTTCATCATATCCAAGCGTCTGGCCATCAACTTT
CCCACATTCATCGTCAAGCTATTCACCGGGACGAGTTGACTAGGCGTCACGACATACCGAGAGCTACGCTTCACCGCGTTCGTACTAGCTGATACCTCAT
TATCGACCACCACATCCAGTCTACCGTCACGTCGCTCCGCCTGTACAACCCCCTTAACATCCAGAGAAATGAGATTTCGAAGCTCGTCAATCGTCTCAAT
CTCTTCGTCGAAGCGAACTTCGTAGTGATCCTCAGGGAACGGCATGTACCGCTGCACACGTGCTGGATAAAAGCGTCCACCTTCTTCTCCACCACGAAAC
GCTAGCACTTGTTGTCCGTACTGTAGAAGCTTCAAGTCGTCGTCCTCCACTTCTCTAGATGGCGACAGCTTGTGCAGTTGGAAGCGCTTTAAACACACGT
CCAGTCTCTTTTCCTTCTCGGTCAGCAGGTTTGCTACAACCGATTGCTGGTCGCTCTCCACATCTCGCTCGTACATGTGGAGAGAAAGGTACGACACATT
GGCGATGTCCTTGACTTTCCCAAAGACAAAGTCCTGGATCGGCCACGATGGATCATGGGCGTTGTAGACAGTTAAGCTTTGAATACGTTCGGCCTCTTCC
AATGTGCCGTCTCGGCGAACTGGGACGACGGTGAAGTAAACATTCGCTGCGTTCCGTAGCCGCTGAGTTGAGTTCTGAGTCCTGCTCTTCGTTGAGTCTT
CAACAGCTTCAAGTTCGCTTGCAGTGCTGCTACGATCACCAGCTGTAGCGGAGATCAAAAGGTTCTGCGCCTCGTGGATACGCAAGTGAAGGTGCTGAGT
ATCAATACCGGGATACTTTGCATCACTGAAGATCCCAGGATACGACAGCGACAGAGAGAACTTTTCCTTGGGCCACGTTGCTGTGCTGCAAGTGCCTGGT
TTCTTAGACTTAGAGGTTCTAATTGGAGCTCCAGGTTGAAGAATCTCAACCTTATCGTCGTCAAACTCGTCCAGTTCTCGACTCGACTCCGCCAAGACTT
CACCTTCTGAGGAGCCCAACGACCTCTCCATCGGCGTGTTTGACATTCGCTGCAGCAAACCTGCCAGTGCCGTTGCATTCGCAACAAATTCCGTTTTGAT
ACACAGTTCTCCTAACTCCTTGGCATCCTCCTTCATCCAAGGCTCGGGCTTTAATTCGTATCTCCTCACCAATTCTTTCGACGAAAATGAGGTAGAATCC
ACCGATTCGCGACACAAATCGAGCAACGGAATCTCCACACGTCCGAGCGGGGTACTTCTGCCCACTTTATTGTTGTCCTTGACATGAATTAACAGCGAGT
TCGCCTCGGAGAGGGAAACAGTCTGCCCAGCACAAAGATACATTAGATAACTACGTTTCTATCACAAACAACATGGAGCTCTCACTTACGTTGCCCAATA
TGAAGCTCTCGTTCGTCCAGACAGGATTCAGTGTCTTCGACATTACAGCGGTGCGCTTCTTCTCGGCTTTGATAGCCTTTCCAGTGCTACGATCCGTGAT
GTATAGCGTGCAGTACGGGTCGCTGTAGCCATTCATATCGGCAGGACTAAGTGCATGCCCCGTAAGAATCTCCACCTTCAAAACTGGCTTATCAGGGCTC
GTTTCCACAGAATTATCCGAGCGGATTTCGTTATTCGCCAGCTTAGTTCGGTGCGTTGATACTTCTGCTTGCGTACGCTTTGAGAAGATCGTATTGCGTG
CTTTACCTGCGCTTCGTTTGCTCTTCTGGGGAGACAACAAAGCGCTTGTACGCTTGCACTCCTCGACACACACGGATGGATCCAGCTCAATCACCGCGTA
CGGAGTAGCAGCACTGTCAGTCTGCTTATGGTTCGACTTTAGTTCAGATGTCTGCAGTACCGTCACCTCGAGTAATGCCTGTCCTTCCAGTCCCGTACGT
GCTTGAAAGCTTTCCTCACTCGACGTTTTCTCTTGATACGCTCGTGGGATCTGAGTGTTTAGGTAGTGGATACACCCGTTAATACCATAGAAGCGCGGGT
CGCGGGCCTGGTAGTCAGCCACAGCACACGGAATGCGCGCTCCATCCAGCTTACAAGCCGCGTCATACATGTCAATCTGGGCGTTCTCATACTCAAGCTG
TTCGACGGACTGACTGTGCGCTTTCAAGTGAAGCTCCTGGTCGATTTTCAGTCGACGCGCATGTTCACCACGCCTCTCACCGATGAGCCAGATCTTGAGT
TGGATCTCGCCAAAGTTGTCGCTTGTTGGCATGTCTTGCTCAGGCTGTAGTGTGTGCCACTCCGTCCACTTATGAGCAGATAGTTGGTCAAGACCGATGA
GAACAAACCCAAGAGGATCGTTCCGGTGGGTCTTGTCATGGTCAAGCACGCGCACTTTGAGGCTCGCTGCCGTCTCAATGTGAGAGATCAAGCCAAACAC
GTGATGTTCATTGGTCCACGCCGGGTTCCGCGTACGATGCATAGTGGCAGTCGTGGCAAACTCACCCGGTATGGGCTTCCCCTGGTCATCCAGCAACGTA
AGTTCATAGTACGGATCGGACGAGTCACTGATGAGATTTCTAGCTGCTAGAACCGTCACCTCTAAGCGGTCGTCAGTGTGTTCGTCGCTCGCTGTGGCCA
CCGGACTCGTCGGTACGAAGTCCAGCTCTACGTTGTGAAAGAAATCCACCAGATTGGGCCCCGAAATGCTCATGTGCACACGTAATTCGCCCCAGGCTTC
GGGTTTCTCTACGGAGGACGGTGGCTCTACGCGAAACCATTCATCGATCAGCTCGGATTGCGCTGGACTAGTTGGTGACATGCGGAACCTCGAGAAAGGA
ACGTCGACTGACCCCAAGCTGTCGTGTCGCTGGAAGGTGTCGTGGTCTTTCAAGACGAATCGAACGAGCTTGACCGTGTTCATGTCAACAACTCTACCAA
GCTCAAAGGAAGCTTTCCATACTGGCTCGAGCGTTGAGGAGATGACGTCTGTGCGTTTTTCCTCAACGTCGATGGGCTTTCCATCTTTACCAATGAGCTT
CACAATACAGTACGGATCACTCTTCCCGTTCATGTCGGCAGCTTTAAGCTTCCGAGCCTCCTCCACTACCAGTTTAAGAAAAATTCGGGAGGGCGGAGCA
GGACGTGGAGGTGGTGGTGGAGGCTTTGGCATTGGCGATGGCTCTGCTGCGGGTTTAGGCAGCTCAGCAGCGGGGGGTTGTGGAGCTACGTCCGGGGTGC
GACGGTAAGCGTTATAGATGGCTGTGATCCATTCGTCCTTTTCTCCTTCAGTGTCAGCCTGCATATAGAAACTCGCCTGACCTGGCGCCGCTTGGAAAGC
GATACAATTACTGTAACCTTGGTCATTCGTGCCAAGTACACTCGAGTCCAGTGTCAGTTGGTAGCGACGACGTGGAGCTGCGTCTTGTGGCGATTTGGAG
TAAGACAACTCGGTGCTTGTCAAGCGGAAGTAGCGCCGACGCCAGTTACCAACGAGTTTTCCTCGTCGACTGCGTTTCTGAAGCCATCCCTCCTTGATGC
AGATTTGATCACTCATCGTGGGGGGATGACAGCGAGAATTGGTTCCCTTCTTCTACTGTAGTGAAGCTCTTTCGGATCCTCTCCTCTGTGGTCAGGAGCT
CGCTGCTTCACTTGTGTTCATCGCAGGTGTCCCCTCAAAAGGTT